5T7BA

Argonaute-2 - 5'-(e)-vinylphosphonate 2'-o-methyl-uridine modified mrttr guide rna complex
Total Genus 227
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively.

Total Genus
227
sequence length
837
structure length
802
Chain Sequence
FKPPPRPDFGTSGRTIKLQANFFEMDIPKIDIYHYELDIKPEKCPRRVNREIVEHMVQHFKTQIFGDRKPVFDGRKNLYTAMPLPIGRDKVELEVTLPIFKVSIKWVSCVSLQALHDALSGRLPSVPFETIQALDVVMRHLPSMRYTPVGRSFFTASSNPLGGGREVWFGFHQSVRPSLWKMMLNIDVSATAFYKAQPVIEFVCEVLDFKSIEKPLTDSQRVKFTKEIKGLKVEITHCKRKYRVCNVTRRPASHQTFPLQQESGQTVECTVAQYFKDRHKLVLRYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIRATARSAPDRQEEISKLMRSASFNTDPYVREFGIMVKDEMTDVTGRVLQPPSILYGGRNKAIATPVQGVWDMRNKQFHTGIEIKVWAIACFAPQRQCTEVHLKSFTEQLRKISRDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYAGLQLVVVILPGKTPVYAEVKRVGDTVLGMATQCVQMKNVQRTTPQTLSNLCLKINVKLGGVNNILLPQGRPPVFQQPVIFLGANVTHPPKKPSIAAVVGSMDAHPNRYCATVRVQQHRQEIIQDLAAMVRELLIQFYKSTRFKPTRIIFYRNGVSEGQFQQVLHHELLAIREACIKLEKDYQPGITFIVVQKRHHTRLFCTDKNERVGKSGNIPAGTTVDTKITHPTEFDFYLCSHAGIQGTSRPSHYHVLWDDNRFSSDELQILTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKRDHQALAKAVQVHQDTLRTMYFA
Loading diagram...

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

publication title Protein structure
rcsb
source organism Homo sapiens
molecule tags Hydrolase/rna
molecule keywords RNA (UVP)UAUAGAGCAAGAACACUGUU
total genus 227
structure length 802
sequence length 837
ec nomenclature ec 3.1.26.n2: Argonaute-2.
pdb deposition date 2016-09-02

pfam database annotations

chain Pfam Accession Code Pfam Family Identifier Pfam Description
A PF02170 PAZ PAZ domain
A PF02171 Piwi Piwi domain
A PF08699 ArgoL1 Argonaute linker 1 domain
A PF16486 ArgoN N-terminal domain of argonaute
A PF16487 ArgoMid Mid domain of argonaute
A PF16488 ArgoL2 Argonaute linker 2 domain
Image from the rcsb pdb (www.rcsb.org)
cath code
ClassArchitectureTopologyHomologyDomain
2.170.260.10 Mainly Beta Beta Complex paz domain paz domain 5t7bA02
3.30.420.10 Alpha Beta 2-Layer Sandwich Nucleotidyltransferase; domain 5 Ribonuclease H-like superfamily/Ribonuclease H 5t7bA04
3.40.50.2300 Alpha Beta 3-Layer(aba) Sandwich Rossmann fold Rossmann fold 5t7bA03
2FTKE 2OZMA 3TAEA 4FLWA 3KLIA 4C8OA 5IUKC 5DGCA 3LUDA 2FXIA 3HDVA 1VSLA 4CECA 4KFBA 3VN5A 4B9VA 1QS4A 4DTRA 3RVKA 5FWYA 4KHWA 1BHLA 2FQYA 1QO0D 3GV0A 2HQBA 1KGSA 2E4ZA 4FJMA 4FLYA 3FMVA 1JWLA 4CESA 2A9RA 3KHTA 5CNIA 4E19A 3KLNA 2FBVA 4CHQA 4M45A 3K5MA 2XY6A 1NXXA 3CM5A 3I0RA 1ZHHA 4DTOA 4CIGA 1QP0A 2PUGA 3DLEA 1LAWA 1EP4A 2G8UA 5CNKA 5T3YA 2F8SA 4M3YA 3UKJA 3O74A 4Z0UA 4RY8A 4DSJA 3FFXA 3DRRA 1FKPA 1ASWA 3VQ8A 2G8FA 5T7BA 2XRIA 1T03A 2MSLA 3QELA 4RK5A 1N6QA 1Q8IA 5KGXA 1I39A 3NDKA 4MRMA 3NH2A 1JL3A 2JVJA 2X74A 3L2WA 1VPWA 4CBVA 4E7JA 3QIPA 3VQ4A 3OM1A 2L18A 4RXTA 3F6PA 4CIFA 3ASMA 1NK6A 3DM2A 1HEYA 3HSTB 5CYMA 4YWHA 2KZMA 2A9QA 4RKQA 3MXJA 2JRLA 3HS3A 5HRNA 5B3JC 4CJQA 3QNOA 1RZRA 3T38A 1DRKA 3TD9A 4S05A 1PHRA 3TAQA 1SI2A 3PO4A 1M2FA 2ITGA 2D0CA 3NH0A 4YS6A 3TARA 3B2NA 3SUPA 2IGIA 1JYFA 3OYNA 3TWHA 3MXIA 4KB1A 3HK2A 1SKSA 2VK2A 5B3JA 2L5CA 4J2EA 3AA2A 4FM2A 1QSLA 3DRPA 3SNKA 3PX6A 4DG1A 3ZSZA 2FMHA 2LUOA 2QR3A 1DC8A 4FJ7A 2BE2A 3KKRA 3HJFA 1SL1A 3NF7A 1UAXA 3M8PA 4OPKA 1U4BA 4YLEA 2YHAA 1ZBIA 4ETIA 2H0AA 3F9KA 4NGCA 4DS4A 4CEOA 2FKAA 3QLHA 4OKKA 2IOYA 1VRTA 2P51A 4Z4FA 5JNRA 4CERA 3RR8A 4QOZB 3RMBA 1NXVA 3ZSYA 4Q7EA 1TKDA 4NCBA 4XAQA 3RVMA 5BRJA 3OQNA 1NKEA 3PY8A 3H6GA 3IPCA 2XFMA 4OATA 1E6LA 3LANA 4CHYA 4W5QA 4RXUA 1G15A 2XDYA 1FK9A 4DU3A 2VG5A 3O4QA 3JSMA 5DLEA 9ABPA 1S9EA 2YNHA 5J2NA 2Q5CA 3GWGA 3OYGA 1JX6A 3M8RA 1X9MA 4FZXC 1UOCA 3Q9SA 1P8AA 5BQ3A 3CRNA 5HKOA 3LKBA 1DBPA 2CHEA 4N03A 2XY8A 1TMYA 4JA2A 5TPWB 4CJ4A 3MYYA 2BGGA 1RT5A 1RTIA 3O2SB 2HSGA 3RVJA 4EVSA 4Y9TA 5IEJA 3N8IA 2F96A 3C6UA 5TQ2B 3ROTA 1NATA 1ASUA 3TI0A 1TKXA 4XARA 1VSHA 3O75A 2M98A 1FXXA 1GUDA 3THVA 4KKOA 4NH3A 2QU7A 4IF4A 3H5IA 2FEWB 2L19A 1ABEA 2OQRA 2FBXA 4PEVA 1RNHA 5J2PA 2E6MA 4BE2A 4RY0A 4FJIA 1Z17A 1E6MA 4CFAA 4MQFA 4CEZA 4FE7A 4KNYA 1WSFA 3V9WA 4CK3A 4EYQA 3JVIA 1EKEA 5D3GA 4FLVA 4KMRA 4MR9A 4O1IA 4NGFA 1IKYA 4EZ9A 1USKA 1TKTA 3KLOA 4KQCA 5GOTA 1Q9YA 5KQMA 2N9UA 1QE1A 5DMRA 3SG0A 4RKRA 1E6KA 4FM0A 3VA0A 4B9NA 3SUOA 2EHGA 3VQ7A 3N0RA 4KK3A 4GW6A 3IPAA 3URMA 4WT7A 5CY4A 3N53A 3OJSA 4YCSA 1BDJA 3QK7A 4RK7A 3HVTA 3L49A 2FN8A 3TAPA 1M5UA 3T6KA 1L5YA 3QLVC 4M3WA 2X6SA 3KIOA 1ZGZA 3AVAA 4L8RB 4CFBA 3QLUA 3WNGA 3SCXA 3F7NA 3V9UA 2YNIA 4G0ZA 4PE5B 2JLEA 5FROA 1EAYA 4EVQA 1D8YA 4J2BA 1MB0A 1LK0A 1NK8A 2NZUG 2Z1JA 1RCHA 2LSNA 5DTEA 5FDLA 4CEQA 1DTTA 1YTAA 4AHRA 5KI6A 3VQDA 3S3NA 4KPYA 3KTQA 4KRFA 4S04A 1F21A 4FLZA 1JH9A 2HJ9A 4WXMA 1S5JA 2BDPA 2RJOA 4JRPA 4DFPA 3QEMB 4FCYA 3LZIA 4OKEA 6CHYA 1ZBUA 1RT4A 1LW0A 1NK7A 5HQJA 4CGIA 3NNDA 1K68A 3OYJA 2WY2D 4KHUA 4J2DA 3MA0A 5IULC 2CD7A 2BANA 4FJNA 3LWMA 2IDMA 2KQ2A 3ALYA 2LBPA 4MQFB 1VSJA 1BI4B 2YKNA 4CGFA 2IS3A 5FWXA 2WONA 5JNWA 1YTUA 3CFOA 4CJPA 4P98A 3MEEA 3U3GA 1WNSA 4CJLA 3O3GA 3ZSOA 4FJ5A 4NGBA 2ID7A 1L5UA 1Z15A 1GCGA 3OS0A 2FN9A 4CJUA 4MS3A 1ZITA 2QXFA 4DSLA 1JKHA 2GKGA 3V9XA 3G1WA 3IP5A 4RK0A 1QP4A 1JBEA 4KI4A 1U48A 1TK0A 3I45A 3SUQA 5KGWA 1RDCA 2R47A 4LSLA 4JLHA 1S1TA 3C95A 1EWTA 1BAPA 3OYLA 3VQAA 3MJ0A 4JRQA 2QKKA 3LUHA 4E3SA 5JNSA 2E4UA 4DSEA 1GOBA 2QZJA 3UK0A 5KTQA 3NE6A 1IKWA 2WOMA 2Z1HA 5TPWA 1JLCA 2DTUA 4LE2A 2G8KA 1IH7A 4DN6A 3AO3A 1VLZA 3OYCA 1BCOA 2CWDA 4IBNA 1L3TA 1DBQA 2QSJA 1DCMA 3CG7A 1D5WA 4MS1B 1XHEA 3TMYA 3LUCA 1TVMA 1Y1LA 2FC0A 3ZCMA 2WWVD 3H1GA 3AV9A 1J53A 1NTRA 1WSIA 4G0MA 4BE1A 4FJKA 4BDYA 2HHQA 4YRZA 3DMJA 3QERA 3OQMA 1RBSA 4JB0A 1CZ9A 5E41A 4OTZA 1K6YA 4Y1CA 3BBLA 4D6YA 3RVPA 1B92A 3V9ZA 4MQEB 4DTNA 1URPA 4LDAA 1C1BA 3EODA 4D6XA 1SD5A 1XHXA 1NOZA 1LBIA 4KFCA 5CZ2A 4NHAA 1UA1A 4DTUA 4MQ3A 3ZSWA 1A2OA 4H8KA 4LY7A 1EWVA 2PUBA 1RBTA 3QLTA 1J54A 2FMIA 1VSEA 1HPZA 4NH5A 2FQWA 4ID1A 1XHFA 4FW1A 4FM1A 4W5NA 5GQSA 2FLWA 1A04A 3I42A 3HP9A 4EZ6A 4G0YA 5FRMA 3L6UA 3G10A 1CLQA 1JXEA 4EYGA 3C6QA 1KRWA 4YR7A 1S8NA 5HP1A 3ROFA 2ZAYA 2QV0A 1HYSA 1A5XA 4HTUA 3H5OA 1TAQA 1HYZA 4XXHA 1S1XA 1IIBA 3EDCA 5HSGA 3IG1A 4G97A 4IILA 3OYBA 1U8TA 4O1HA 2JB9A 3KLGA 1ISRA 1YMUA 3IP7A 1QMPA 4WXEA 2QVGA 1YK0A 1LWFA 1HJRA 2R48A 5EWLB 3AO2A 2VUIB 4N5SA 3OLYA 1GUBA 2HHSA 3Q15C 1KFSA 4OVLA 1QSYA 5ABPA 3LP1A 4CJRA 3SQ4A 4KB0A 2I6FA 1X9SA 3LWLA 5IC5A 1KMIY 1TK8A 3SQ1A 2PUEA 3S99A 3VQ5A 4CF8A 3M8QA 2B4AA 3EAFA 2R7YA 1NXPA 3KLFA 1CEYA 1U04A 3L3UA 2PZSA 3O1JC 4F2SA 1TJYA 3V1RA 4IMIB 2OYQA 3ZSVA 4LE0A 2Z1IA 4RK6A 3CG4A 1S1WA 4WE1A 2PJUA 1MIHA 4MS3B 2GX6A 4HCBA 2J48A 3NF8A 3KK2A 4G0PA 2DRIA 4JS5A 2A1RA 1QQAA 3AO1A 5IBQA 2CHFA 5EWLA 3K5NA 3DLHA 4AHCA 2B5JA 2W42A 3HYFA 3MEDA 1F4VA 5HRPA 3SQ2A 1BI4A 3QESA 7ABPA 3ZT4A 4I9LA 5D2CA 1U47A 1L3VA 4MR8A 4M3ZA 2D0BA 4DS5A 1FFGA 1NK4A 3RMCA 1CYEA 1JF8A 1T05A 1HYVA 4B9MA 4F11A 1C4WA 2AYZA 3LAKA 2X6NA 2WJWA 1S6PA 3AO4A 4PYRA 2HHWA 3M9XA 4NH6A 3H75A 4PZ0A 4YV7A 3SNNA 4C8NA 1RT1A 4KTWA 2E4XA 3I09A 4Q6WA 1SV5A 1PNRA 4HUEA 2DFHA 2DY4A 1VRUA 4KREA 3HZHA 3LDSA 5TQ0B 1XI1A 1NK0A 3SUNA 3O3FA 1ZVVA 4RV5A 4H4OA 4FZZA 1EETA 3KYIB 1ISSA 2PUFA 4CK1A 4CHPA 4DF4A 3OLVA 3HEBA 3KKEA 2EX3A 5TPZD 4LRQA 6ABPA 3MECA 3VA3A 3HDGA 3F6CA 3LALA 5IX8A 4BE0A 3LUFA 3QLVA 4PY5A 3JYTA 2D0AA 3NBMA 4E7HA 4M3UA 2IAJA 4QYWA 4EGSA 5TPZA 3VQ9A 1IKXA 1BIUA 4B9UA 1Z16A 2A1SA 1DZ3A 3CZCA 3NNNA 4CCHA 1GOCA 5PNTA 1RDAA 3SJJA 1QO0A 4ZJPA 3NHZA 3WNHA 4YGXB 2L2QA 4CEAA 3D8UA 3V81A 4KHQA 1JFVA 3P1GA 4MS1A 1BVHA 4AHSA 1X9WA 5TQJA 2NT4A 4F2RA 2GWRA 3LUKA 4KZKA 1JL2A 3T95A 3O6EX 1VSIA 4NYFA 4B9LA 3AVLA 3C6TA 1AB6A 1VKRA 3Q7SA 1CXUA 1NJWA 3VNBA 1BIZA 4LZLA 4LSNA 3K59A 1Z12A 1JLKA 1VSFA 2PAFA 3AVCA 1T8EA 4K8ZA 2JBAA 5JNTA 1USIA 4CFDA 1S6QA 1RT3A 2GUIA 3CS3A 1UA0A 1QP7A 3NFAA 3P9YA 2FBYA 5CYQA 3DOLA 3EZ5A 1J9AA 4MLDA 4LH4A 4E0DA 1DRJA 2G8HA 4O0JA 2F8TA 1QQCA 3RVLA 2QXYA 3HPOA 3IP9A 4F8RA 4CEFA 1BISA 3S3MA 1JDNA 4ETMA 3JTEA 4EP4A 4MR9B 5CNJA 1R8JA 4FK0A 4UHJA 3M8SA 1ITGA 4Z4HA 4MPTA 2E4WA 2VG7A 4G0XA 1ZBLA 1S1VA 3H08A 3QEWA 1NK5A 2P5GA 1YT3A 1BA2A 5JNVA 1MAVA 3PUFA 3SPZA 3AA4A 4ZMSA 1DJMA 3V6DA 1RTJA 4HVJA 3EQZA 3RRGA 3HXMA 2HHVA 5DCLA 3O7XA 4D74A 4MGEA 4HYEA 1D1PA 3AO5A 2HHXA 3EJWA 4H3KB 4E7PA 3ILHA 4B08A 2HHTA 4CJFA 2AJQA 1JFSA 1LWEA 3RMDA 5EWMA 3ZT0A 5C24A 4RY9A 2HPHA 3EY1A 3H5LA 3IDOA 4FE4A 2JGUA 3HSYA 3ZSRA 5TQ2A 4Z99A 1KCFA 3H1EA 3OYMA 2I5JA 2MYPA 4G1QA 1RBVA 2IDOA 5J1EA 4ELVA 1D9DA 1ASVA 2HQRA 1JL1A 2GBZA 2VYCA 1RT7A 3B6OA 3AVFA 3WNEA 4LX8A 3QO9A 3U3YA 2B1JA 2D5RA 3IP6A 2IOCA 1M2EA 2FVYA 1P6UA 3F73A 3BREA 4Q0BA 2RJNA 4KVFA 1JLAA 3OO0A 4YNQA 3SAJA 4DQPA 1TKZA 1VYNA 3LFTA 4I2QA 4FJJA 4HNSA 2VWKA 2QKBA 3U6FA 4RK1A 4E7IA 3HUUA 1Z25A 3GRCA 1ZBFA 1A0OA 1C6VA 4XIUA 3OYHA 2NT3A 1ABFA 3Q41A 3JS5A 1Z13A 2IC3A 1D2AA 4CJWA 1XC9A 5C5EA 3EYZA 3KK3A 1MVOA 3TABA 3C97A 3NGZA 2IPAB 3H6HA 4WZZA 3OYIA 3B6PA 4DTXA 4O55A 3O3HA 2V0NA 3FGZA 4MS4B 3AVHA 3TO5A 3AVIA 3C3WA 5TQ0A 3P5JA 3LTEA 3KD5E 3LMKA 2ZQBA 3RMAA 4C8MA 3SQ0A 4GPAA 4DTMA 4AHVA 1VRVA 3KSMA 1GLGA 3IRXA 5CHYA 2OZSA 4L85A 5I3UA 2DFFA 2HVIA 1GOAA 3L2VA 5CZ1A 4AHTA 1ZN2A 4PICA 1Z18A 5FWXB 3RTVA 1APBA 4ZYLA 3DGEC 4UHKA 1D1QA 4KTQA 1SXHA 1J56A 4TN5A 3O3IX 1BCMA 1RT2A 2Y1IA 1BQMA 4O44A 2PMCA 3I0SA 3JPYA 5HROA 2PY5A 3ZT2A 2MSWA 1PUXA 1KVCA 4JS4A 5KQLA 1L5ZA 1FFSA 3HT3A 2P4UA 2GBPA 4RG8A 1WETA 1LW2A 3L3VA 3FFTA 1T2RA 3ZSQA 1J5OA 4RW4A 4K8XA 1R0AA 2YNFA 3K58A 2LIVA 4YFUA 1RZRD 4MAAA 4E7KA 4PQUA 3HPGA 3HVRA 3CFRA 1T2SA 2G8WA 3GYBA 2PL1A 4FJHA 4RW7A 3O21A 1A5VA 5FBKA 2Y1JA 3FFWA 4M42A 4CJ5A 1OXKB 3OJUA 2JBAB 2MYNA 3D0PA 1L3SA 1DLOA 3FDFA 4H60A 1KVBA 1D5AA 4CF2A 2M1ZA 5C42A 1YS7A 3JPWA 3ITHA 1KRXA 3CKMA 1HMVA 4N0PA 2RPIA 3S9HA 3K5OA 4Z0NA 4KHNA 4W5TA 4ZTJA 1SRRA 3O2QB 3T3FA 4CJ3A 2JVIA 4FB4A 2PUDA 5JS1A 3UUGA 3OY9A 2YKMA 4PA1A 4LD0A 3N0WA 4OLBA 4CGJA 4DQRA 4KV7A 3LUJA 4R5PA 3OM0A 1D9FA 3SY8A 4FZYA 4XFKA 2IPLA 4RSMA 1C1CA 4OBBA 2NZVG 3KCNA 1ZAYA 1I3CA 2VUHB 4F4KA 1C0TA 1JLFA 4IG3A 4LE1A 4NGDA 3OMXA 1WSGA 1R6ZA 3Q7RA 3HUTA 5HBMA 3SPYA 1P6QA 3DOKA 4F12A 1RXIA 1SXIA 4MR7B 5KC9A 2PUCA 5KWSA 2P5OA 4G0QA 2FEKA 3D45A 1I3AA 3KS9A 1WSHA 2P9HA 3N75A 2PKXA 3CFYA 4DTJA 1NK9A 2E6LA 3D02A 1REVA 3K9CA 1U49A 4I7FA 3VQPA 4DLGA 1QSSA 1LJLA 3NAEA 4MQEA 5I4CA 4B8AB 1EX4A 3OMWA 2ID9A 2WB4A 4MYRA 4KTZA 3HO1A 3V9SA 4FXDA 2GI4A 3QX9A 4N47A 3LPUA 1RBRA 1B9DA 4OLAA 3AVMA 4NCAA 4W5RA 2WMYA 3ISNC 1ZESA 2FMKA 3UIQA 2AYXA 1QKKA 5IUNC 4HNRA 4EYKA 4N0QA 1XHZA 2X78A 1VK0A 4EY3A 2IYNA 3RVRA 2RGYA 4FJ8A 4ZMRA 1FFWA 1NY5A 3DRSA 3WNFA 4XLTA 2VWJA 3G85A 1QNLA 1EHCA 3IAYA 1DCFA 3H5WA 1WLJA 3R0JA 2NUBA 3N0XA 2HNZA 3VQCA 1DC7A 3IS9A 2QK9A 1N5YA 4MRMB 4ETNA 3W9SA 4CGHA 1FSPA 3HM9A 3C3MA 4CIEA 4FLXA 3C94A 4IDKA 1KLMA 1ZDMA 1NJYA 4MR7A 4Z4GA 3QEVA 1NKCA 2KTQA 1ZY2A 3Q7TA 3ULDA 4DLEA 1S9GA 4HCCA 4HUGA 3T1AA 1P2FA 3C3KA 4JASB 1LWCA 4YP9A 4QAGA 5IUJC 4CGDA 1JDPA 4QICA 5HRSA 3RH0A 4ICLA 4CJTA 4DU4A 2XY5A 4YO7A 4AH9A 4DTPA 1B00A 5FWYB 1JLBA 1RDBA 3T8YA 3RRHA 5J2QA 1JLGA 4DQDA 4CHZA 3OYAA 5F64A 2YHBA 3O2JA 4E89A 4PUOA 1C1AA 1Y97A 1LJUA 1LBHA 4M3TA 4RWEA 3TR8A 5TE9A 4DSFA 1SI3A 1ZBHA 2O4GA 3O4NA 4CJSA 1DCKA 2FW0A 4Z9BA 1JXBA 4CF9A 1ZGGA 2MSKA 4DQSA 3MIZA 3RVNA 2XO7A 2VG6A 4Y1DA 3VQ6A 4KAZA 4IGAA 2RKIA 2OPPA 4C8KA 3DI6A 4CE9A 3SV4A 5SZTA 4O4GA 2LPMA 3L2RA 4BDPA 1HQUA 2JK1A 4IMJB 1NXOA 4QYMA 3GBPA 3CQ8A 3T19A 2R4QA 4QCLA 3I5AA 1HRHA 4JAVC 3HPHA 4CEDA 1QPZA 2GV9A 3NGIA 3OLZA 3PV8A 3OQOA 3TB6A 2ZD1A 2JCGA 4F3TA 5C25A 1TV6A 3GT7A 4H3HB 2B4JA 1LAVA 4FJ9A 4BWMA 4FJXA 4PWDA 1NJZA 2L5DA 3NNSA 3KK1A 2IPNA 2RN2A 1RBUA 1ZH2A 2QW1A 1D4ZA 4BWJA 3HL8A 5KQPA 1W9HA 4DMNA 4FK2A 4G0OA 3GA5A 3RVOA 3BILA 1RXEA 3K4HA 4FK4A 3RWUA 1BDIA 3OYFA 2Q3SA 3VQQA 3BGRA 1FQWA 1SXGA 4CJEA 3MEGA 1XWLA 3V1QA 2PE5A 1JYEA 3SM9A 5SWMA 3L8BA 5HLFA 2HQOA 3DGFC 4J2AA 3N6VA 4IKFA 3NBPA 1HNVA 1KSPA 1GCAA 2Z1GA 4Z4CA 2HHUA 1PEYA 3DLKA 5EU7A 4JP1A 1H9CA 1VSDA 4Z4EA 3PX4A 3QIOA 1EFAA 4B8CA 4KV8A 4EP5A 1YMVA 3SZ2A 4O5AA 2XHBA 4ZHRA 3RR7A 3AA3A 4NICA 1IKVA 3A10A 1W25A 1RPJA 4TSXA 2FBTA 3LKVA 4LDZA 4NV3A 4CJVA 4EVRA 3NH1A 1L3UA 3OS2A 4IG0A 3OLXA 3TAFA 1B9FA 4EUKA 1AB5A 2WRZA 4E7OA 3NGYA 3EULA 2IKSA 3DBIA 4I2PA 3SI6A 3JVDA 4XASA 2OPRA 4OGCA 4FW2A 3HP6A 5EWJB 4BACA 3QIRA 4WWHA 3S3OA 2KW4A 3KJXA 1M5TA 4RXMA 1CZBA 3PX0A 2O20A 1YVUA 1KLNA 5C5CA 1FKOA 3KD1E 4OGEA 1JLQA 1E2BA 4DF8A 3SQNA 4CHOA 3QNNA 2QVWA 3VQEA 1TL1A 4OG2A 1BQNA 1Z26A 5CNMA 4RW8A 3MXMA 1IG9A 4TLMB 2P1JA 4ML3A 2ATQA 3I8DA 3OYKA 2TMYA 2E4LA 4RS3A 1TAUA 3H5TA 3MMNA 1O1WA 2PL9A 2L17A 4GNRA 2PYLA 2LP4Y 4NGGA 4DWIA 4KO0A 1QQBA 2HVHA 1YIOA 5DKFA 1RTDA 2ETJA 4KI6A 4MLCA 4DFJA 4FLUA 1EWKA 1NOYA 3HCWA 3M9WA 4P1ZA 4FVMA 1JHZA 2OA8A 4F3OA 1DG9A 4ELTA 5FBHA 3RQIA 3A2FA 1BL3A 1A5WA 3LAMA 4B9TA 4DU1A 1NXTA 4B9SA 5I42A 3LP2A 4O5BA 4Q5VA 2HB5A 2O4IA 1HNIA 3G0ZA 2OPSA 1SL0A 2HNYA 2DFEA 4CEBA 1T7PA 4AHUA 5FRNA 2MYTA 4CFCA 3OYDA 2XY7A 3MAQA 1K66A 3CNBA 3CYMA 3TAMA 3OO1A 3EGCA 1RILA 1DTQA 5HRRA 4IFYA 2FMFA 3CLKA 3QINA 2KFZA 4F8JA 3CHYA 3VNAA 2JVKA 3OVNA 1EXQA 1VSKA 3V4IA 3MM4A 3LP3A 5J2MA 2FEPA 3KKSA 3H5VA 3E61A 4DSIA 1TL3A 3GL9A 3MQ4A 3QELB 2KZZA 5KQGA 1KFDA 3DYAA 1WSEA 4B09A 4FJGA 2H3HA 1C0UA 3K2PA 3LUGA 2YNGA 1OXBB 4KQ9A 5K14A 4CF1A 1HQEA 2HMIA 3RVSA 3GBVA 2QVCA 1JFTA 3LPTA 1YS6A 3CU5A 1DBWA 1TK5A 3CM6A 4W5OA 3QLUC 4M88A 3M6MD 3NF6A 1TLFA 3QEMA 3TAGA 4DSKA 4H4MA 4NQRA 4M3RA 3LZJA 3PO5A 4CHNA 4FLTA 1IO2A 4ZTFA 1U2PA 1RDDA 1R4KA 4RW9A 3KG2A 1KVAA 4E1MA 3EQ2A 1KRPA 3A3KA 4ID5A 2X7XA 1U45A 3TX6A 1SL2A 3TANA 4ELUA 2FFLA 4Z9AA 1RNLA 1UDRA 2KFNA 3ILYA 3BDPA 3LUAA 3E01A 4N76A 3DZDA 3A0RB 4CK2A 5KRTA 4N56A 1NXWA 4G86A 3MF4A 3SYZA 1Z2DA 1BDHA 2YV0X 1WSJA 1USGA 2MYUA 4RK4A 2E4VA 1CXQA 3QX8A 2IPMA 2HW3A 1DP4A 3K5LA 1QHTA 1KTQA 3QEIA 2A9PA 5JNUA 3AVGA 4FJLA 3CTPA 2OENG 3RVQA 2G8IA 2KYRA 4MR8B 4E7LA 4Q6BA 5KC8A 4BDZA 1TGOA 4UQGA 1UWBA 1X1PA 3H1FA 4CGGA 4CJKA 2R25B 4B3OA 3CZ5A 5E3JA 2HNDA 4QPJC 4HHTA 3NHMA 5HM6A 4N41A 2A9OA 1QTMA 1C0MA 4RZSA 3AVJA 3AVBA 1Z2EA 3HV2A 3SV3A 3ZT1A 4M41A 3K57A 4I9QA 3KYJB 4IFVA 1T34A 1W0HA 1MU2A 3BRSA 3O1HB 3KTOA 1LV5A 3A0UA 2FLKA 1SUQA 2E4YA 1C0EA 4HNQA 5KRSA 4DFKA 1SKRA 4OKJA 4OJRA 4DTSA 1RTHA 3FFIA 1SKWA 4RU1A 4AILC 1U0SY 4TLLB 4GMJB 3AVNA 2ZWMA 1WN7A 3AA5X 2PYJA 4MS4A 4EYOA 1TM2A 1PEAA 1YK1A 3QEKA 3L2QA 3VQBA 4OPJA 1WAFA 3NCIA 1TVRA 4DQQA 3DLRA 3ZSXA 4ZPJA 4M3XA 3JY6A 5BR1A 1BGXT 4JB2A 4GVMA 1Q9XA 4KK4A 4CF0A 1PNTA 4TMYA 3KLHA 4DQIA 1NJXA 5EWJA 4C8LA 4WUTA 4L4UA 4MFBA 4HUFA 3AVKA 1NXSA 4F06A 2PLNA 2WJAA 3QETA 3L2UA 3O1IC 4FYDA 2FQXA 3DLGA 1XWWA 4DFMA 4LH5A 4E1NA 3O7VX 4KHYA 4NYNA 3CFPA 1MB3A 4O0IA 4KHSA 4RDCA 3QEPA 5JS2A 2B6AA 1NKBA 3P83D 4JOQA 1S1UA 2FSPA 8ABPA 3ZT3A 2PUAA 3LP0A 4CEEA 1F51E 1CHNA 1JLEA 1ZYQA 3BRQA 3NF9A 2ZE2A 3E3MA 1ZH4A 3OLWA 1U2QA 2RF2A 5IEBA 4NCGA 3KJVA 4Z4IA 4DADA 1WAJA 4RW6A 3OYEA 3CG0A 3DLBA 4IRXA 2OPQA 1RT6A 3V1OA 3NHGA 2G8VA 3KLEA 3OS1A 5ED4A 1VSMA 5DK5A 3QEXA 5EWMB 3LOPA 2RDMA 5BRAA
chains in the Genus database with same CATH superfamily
4HB3A 4G6ZA 1CYDA 1V6CA 1QIJA 4H6PA 1DXHA 3LLCA 3TAEA 2GLUA 2HMVA 4F9EA 4PFQA 1T8RA 2KMLA 2OG2A 2OOSA 1EQAA 2GZ2A 2Q9BA 3B36A 4P7BA 4PTLA 4N54A 5AQSA 3AUJB 3BXZA 3C4JA 3QYFA 1Q0RA 4FFOA 4ZJUA 3TE6A 5C7YA 4CEHB 2XKBA 3FCAA 3K70C 3UJCA 3VR6D 4CECA 2Q1WA 3A6HA 4NJMB 1UXGA 2JZOA 4RZ2A 1KOLA 3U7IA 3VN5A 1PS8A 4EDHA 5AVQA 5IZ4A 4UCQA 1QS4A 4CQLB 1H9BA 4NULA 2QJRA 1OIVA 1ITZA 3D0KA 2JAUA 4UNSA 5GVRA 4D80A 3K6SA 1GSAA 1Y7IA 4JUBA 2OZLA 2FQYA 4NYJR 4Q1VA 5G0SA 4A16A 5H4GA 1BH2A 2J9RA 4DSNA 4FJMA 1XTIA 1YRYE 2C61A 4AIIA 3AVTA 2R7AA 4L5JA 2BZGA 3NUQA 5EXWA 3KHTA 2GPYA 3RYCB 1E9SA 1V95A 2QF7A 1V8OA 1RRPA 3I2YX 4M1KA 2W11A 1GXSB 1E3EA 5K3FB 1PG5A 1T4DA 2F1JA 1NXXA 3OE5A 1ZHHA 1W9MA 4I3HA 3TIXB 3TZBA 1XYYA 4DTOA 2BTFA 4CIGA 2UUBB 2BZ0A 2I3GA 3WLQA 4F9TA 1YJWN 4XDYA 1YZYA 4C4XA 1CJUC 4IDNA 4WY8A 5CNKA 5T3YA 2F90A 4GMFA 3GDQA 1A5AB 1V96A 2Z08A 3LTNC 1TA0A 2BGRA 4X00A 4Z0UA 2FUNB 4IPTA 4XYEA 1DDIA 4DSJA 2C29D 3A26A 1RXCA 4R1NA 2WWTA 2YIVX 2PKCA 1FKPA 4AUEA 4F4DA 2O7QA 3DAWA 3LQ2A 3PGKA 3PPYA 1FOEB 3V2IA 5BWLA 4HPXB 5C4IA 2QN7A 1XJWA 3F6SA 4F2HA 3DHVA 1ZCBA 3QELA 1U8YA 4ZYTA 4DA4A 1T4CA 3GEEA 3THYA 3NC1C 2YWJA 4L57A 1YZHA 1Q8IA 3JU3A 4RV9A 1FY2A 2PWBA 1Z82A 3Q2OA 1COZA 4R5MA 2XAUA 5I7SA 4NABA 3P94A 4CZGA 5KTYA 3WGQA 4NS4A 3KDSE 2NU8A 2GBFA 3AETA 4BC5A 3QUTA 1JL3A 1Z0FA 5AVXA 1KYZA 3A1NA 4EPWA 1LC0A 2E4AA 2VNKA 1TUBB 5EQJB 1KYYA 3Q9UA 2EJWA 5EI5A 4CPDA 4FOSA 5HZKA 1YR8A 4MHSA 2SKCA 2FHSA 2X74A 1W49A 3DPIA 4CFZA 1F8GA 4CBVA 3AESA 1WXHA 4MWDA 4XYBA 3KJEA 1TYQB 3W6OA 5JZMA 5CYOA 2UZIR 4FGKA 5U1PA 2JLZA 2AX4A 3VQ4A 1JR3E 3A14A 1S3SA 3OM1A 2YJ3A 4RVDA 4EUFA 1ICEA 1U0RA 2GS9A 2EOAA 1CNEA 1PZEA 1WB5A 4XWOA 5CYPA 3F6PA 2NAPA 1RRMA 3IFRA 1Q91A 4S12A 3W5CA 3ASMA 1SU4A 5K0SA 5KJFA 3O7MA 5CYMA 2NP6A 1MV8A 3IE0A 2HSZA 1GZSA 1T9ZA 2PVCA 2A9QA 1KVRA 2JRLA 3AY6A 2IYEA 3GN1A 4TKLA 4D4MA 3FRJA 2O59A 1ESZA 3UKDA 2V98A 4FQ5A 3QNOA 2WUGA 3PITA 1WPGA 2OPBA 3Q3IA 3T38A 1H69A 4ALMA 2OCGA 1INLA 3AVYA 3TD9A 4BNZA 4S05A 3WLPA 1PHRA 3CCBA 4D26A 4WDQA 1JA9A 1H42A 4JR0A 1XCGB 3UF0A 3KYCB 2IYSA 4YS6A 1G5QA 4RDHA 4FYWA 2PZEA 2RK6A 4CL0A 4DKXA 1UZNA 3C6ZA 3B2NA 2PZ8A 1Z3IX 3ET4A 3ZX4A 3Q9NA 1PR9A 5L7TA 2PKRA 1HLUA 2VCHA 3D6VA 3SUPA 1W5TA 2I65A 2PVSA 6GPBA 4JXJA 1JYFA 1XZ8A 2XCQA 3OYNA 1HV8A 1EU1A 4WKBA 5ALFA 4ZWNA 3IE1A 2I67A 4E5DA 4KB1A 3C8UA 2JH3A 3AI3A 2WFAA 4J2EA 3SNKA 3I6YA 4FHZA 1DT9A 1FLDA 4HAVA 4LZOA 4Q21A 2ZLBA 1E8MA 4R8SA 4K3VA 4D0NA 1CETA 2NUTB 4LGCA 1CJCA 2XE8A 5CVDA 3GE1A 1NKVA 4BXOA 4KVAA 2ZWVA 1KC1A 2I4TA 3WOVA 2ZYSA 4UAVA 5E3HA 5C3UA 2C84A 3T5TA 1UBHS 2FF6A 2BDEA 1IE3A 1SZDA 2KM1A 1B26A 1Y3HA 2TYSB 3KU4A 4J76A 5ULLA 5DHRA 3P0JA 3NF7A 1CZNA 1G8FA 3MJEA 1GEEA 3PSFA 3N2IA 4M99A 4ZHQA 2JLXA 5FEMA 3UYLA 1C3XA 2FSUA 2BZ1A 1KIMA 1T3TA 4AN4A 4AVYA 5B6JA 4OPKA 4IXTA 4LHSA 1EB9A 4TS3A 3M5RA 1U4BA 1E18A 2C59A 1SB9A 3KAKA 3KHKA 4GD3Q 4GC9A 5D7BA 5EMKA 5LBTA 4ETIA 2Y1DA 3CCRN 2H0AA 5D3QA 3UANA 2EIXA 4DS4A 4CZIA 1ELOA 1KAMA 3IT1A 4RL6A 5ERYA 1BGWA 1KE2A 3GF4A 3VZPA 1QLJA 3BWXA 1XQXA 2AZDA 5KWVA 4LYGA 4NG4A 3PKZA 1QHHA 2HDOA 4Q7KA 4QDZA 2P51A 2HBMA 2FUCA 5AVWA 1CVIA 3EBLA 3RR8A 5JZOA 1NGJA 2EF1A 3AKZA 5I7AA 1V8PA 4Q7EA 4GOOD 1R2QA 4K0RA 4N6NA 2QL6A 4B9AA 1O9GA 1N5IA 3T3IA 5HUQA 4TKVB 3TIIA 1MOQA 4U8HA 5BRJA 3ZZ1A 1N77A 1FMCA 1YVDA 2G40A 2XIJA 2ZSJA 3JQ8B 3K5HA 3MTDA 4IAOA 3FZFA 4QATA 4QXMA 3U3JA 3TG8A 1I2DA 5BSHA 2V5UA 5BXQC 1NPDA 1K7EB 3RT9A 2VXOA 1M0TA 1ZCAA 1VQ7N 4PAOA 4MRAA 4JI7B 3LANA 2RAVA 1THMA 3INNA 2F7SA 1XJCA 2W2MA 1A4IA 2WKWA 4XD2A 8ATCA 1G15A 4MIOA 2XTJA 4DU3A 4EB6B 3IBCA 5GP1A 4MUXA 4F3NA 2JNWA 4TTRA 2OCLA 2YC2C 1MEEA 1LF0A 4G89A 1A7KA 4YORA 2YR0A 3BX1A 1BMQA 1RWWA 2CD9A 3OFJA 1VHXA 2Q5CA 2V96A 3IBSA 3OYGA 4II2A 5CX1A 5FUWA 5K45A 2QLJA 1JX6A 3HU1A 3SIPA 2C78A 1WUJS 5KPRA 1M7HA 3F6EX 3SJAA 1KAOA 2V5VA 3SDBA 1UOCA 1RXYA 2QVLA 3KOUA 4HYTA 2C9DA 3CRNA 1CEXA 3LKBA 4DCPA 3RARA 4O8KA 2QWRA 4CBWA 2AI3A 3OY7A 2CHEA 3GZ4A 5E6UA 2YKGA 1MUUA 3KL2A 3LV8A 2XY8A 1AKUA 1IU9A 1VIYA 2ONCA 3U81A 4DR2B 3WV4A 2Q3LA 1B8PA 3LY5A 4CJ4A 1K5DA 2C07A 3IJPA 3IKMA 3O2SB 1CY8A 3EXEA 3R1IA 4RYDA 1RJFA 3VVLA 2J85A 3CQXA 2G07A 1GUYA 2QN3A 1J09A 3JD4A 4EVSA 2XZOA 2KHOA 3HYNA 1TF7A 1W88A 2I66A 5CJJA 4FZ3A 1O0BA 2F96A 3CJAA 2SKDA 4NJOA 3C6UA 5DTIA 2O4UX 4RD3A 4DAOA 1QR2A 4XARA 3AY3A 4DNXA 5KWEA 4RTSA 4IIXA 1VSHA 1P4JA 4J43A 4NZNA 3KV1A 2EEZA 4WKNA 2M98A 2PGXA 1G3UA 1GUDA 4DV5K 3THVA 2X1VA 1SCAA 2PN1A 2YINC 4KKOA 2QU7A 3QU2A 1BOOA 3N6XA 4WHMA 4AUMA 1F60A 1RP1A 4IF4A 4WESB 5JWHA 4RJLA 2KLAA 3AINA 1K5GA 4YJ2A 1L5LA 2D2XA 2L19A 3IT2A 1M2OB 1TZCA 4G25A 4H6XA 2OQRA 2XUKA 3IP1A 4YACA 6ADHA 2ZU0C 4PEVA 4PPYA 4O4HF 5IT0A 1YDMA 2C5HA 4UFOA 5JYDA 1W5EA 4OXRA 4L5AA 3TW0A 2ZIWB 3VSCA 5MFPA 3KOYA 4GLOA 3ZDCA 3PUYA 1GPMA 1YNOA 3SQMA 4LX0A 4RY0A 3MQ2A 4BV9A 3T7RA 4LJLA 5L4NA 4N7RA 2H4YA 4FI3F 1YB4A 2VF4X 1GG2A 1UK9A 2F2TA 2RG7A 3COSA 3K6KA 3R7AA 1RHMA 4G5QA 4IMPA 4LXTA 4KHPK 2NSLA 3ULEA 5K0BA 3OTOK 2JGEA 2P90A 4GHWA 4MQFA 4ND3A 3KQOA 2VJPA 2H0RA 2XUFA 4FE7A 3T5MA 4LFCK 4GR5A 3P31A 3PHBE 3ASVA 2XYHA 3DQPA 3M8KA 5IDYA 4CK3A 4A8JC 8ADHA 3V8VA 1BCRB 4GI5A 3ICEA 1FE8A 4RDXA 1LV8A 1EKEA 4D9KA 3MN7A 1FU7A 3HUFA 3YASA 2GCIA 1L7QA 2UXDK 3GFBA 4DV6B 3FMFA 1DAHA 3U4HA 3SFVA 1G5IA 2GBLC 1YO6A 3TQIA 3VGPA 1CE8B 2VJBA 2ZTUA 2O8NA 3E9DA 5DP2A 1DGQA 2GILA 3KLOA 3KFLA 3ZE1B 4H6VA 3ZV5A 4F4IA 4DEXA 3IOYA 2FQQA 1RJGA 1FP4B 2N9UA 1G4UR 4XFJA 2B0CA 4YRNA 4B9NA 2AJCA 4C0WA 2EHGA 1XA4A 1JQKA 4KK3A 2QLFA 3WMFA 3HKDB 1ZHOA 4UXJA 4WT7A 1QQTA 2GAAA 2VRBA 5JMPA 4F3CA 4DQUA 4LZWA 4YMHA 3IR5A 4OKSA 2Q6KA 4K6MA 2VDKB 1II9A 3RSZA 1EXMA 1PJCA 2YFYA 5B58C 5C5IA 4MW9A 2Q4TA 5EVCA 2XUPA 3QLVC 4M54A 3PQDA 3KPJA 4DRYA 1Q18A 4HJXA 5AW9A 1VP3A 4AI6A 2FPRA 1N78A 3AR8A 2MSDB 1LB1B 1IG3A 5EVZA 4LQDA 2FU5C 4L8RB 5FPDA 5A6VA 2PLWA 1XQVA 1O6GA 3DO8A 1SHZA 2IUSA 2ZYAA 3PFIA 5BMVF 3JQ9A 4XH4A 1ZONA 4KR0A 3AVXA 2ALJA 2D0DA 3OICA 4LOJA 1GPKA 5FT9A 2D6FA 5FROA 3P71T 4UVGA 4EVQA 2VRWA 4KE8A 1EVLA 1MB0A 1KQNA 1EGQA 1YRWA 2NZUG 2ZQYA 3TSCA 1T6DA 2PO7A 1Z06A 3EVDA 4CEQA 3EC1A 3GFRA 3ORQA 2JJ8A 4ED9A 3FVVA 5BQ5A 1EQ2A 2ILVA 2VJLA 4Y6LA 1FP1D 2YDYA 3H4VA 1DPGA 4IOXA 5E9QA 2VUSA 1L5KA 2G6BA 2GJ4A 3E9NA 4I1UA 1Y3FE 4FLZA 3NOVA 3HJCA 4JKOA 1L8QA 1HLFA 3GIDA 3R5XA 1G2PA 1F2VA 3ZW9A 4WXMA 1KSJA 4X95A 3HCFA 2NTNA 2WM8A 4L74A 1BN6A 1GO2A 1JJVA 3LZIA 1Q1EA 2PYIA 5COBA 1QXSA 3IEKA 3LGSA 2JFZA 1S01A 2YXPX 3ETNA 1PW5A 1G59A 1ZD9A 2BC9A 4BNHA 4CGIA 1JIVA 2WWRA 3WFJA 3WKCA 4FWRA 2FFQA 4HEQA 4BMXA 3QPVA 5G40A 2H2HA 3QVVA 4BQNA 1NVXQ 3OYJA 1N33B 1QIDA 2ZS9A 3F1LA 1C81A 4HS4A 1E69A 1JU4A 3KQWA 3MA0A 3OFKA 3WLKX 3ZHQA 3DOHA 1XRSB 3QEJA 4LMRA 4TLBA 4UNPA 1WW2A 3ESDA 2CD7A 1GZDA 2WTAA 4ENSA 4LVNA 2BANA 4B7UA 2TECE 3RJTA 4AJHA 2NQ8A 2WTXA 2DWQA 3DB2A 1Z62A 1ICIA 2VIIA 3Q6IA 4JUIA 2ZSHA 4KN6A 5LU9A 1DFGA 2J0QA 1RJ9B 4OQDA 3ZBQA 1H6DA 4B7ZA 1NJ1A 3QPUA 1U2SA 1DTEA 1ILWA 2B4KA 1I7LA 3RFXA 1UMBA 2O06A 4LS3A 5TY0A 2HUPA 3G0BA 3KR0A 2WONA 3Q87B 1MX9A 5DYYA 5I01A 5KNDD 4BFUA 1SBCA 1YTUA 2GFQA 2OO5A 2Q21A 5HJ5A 1UFRA 4DNOA 5CD1A 1W47A 3K31A 3WBFA 3BM5A 2AZTA 3KTFA 2NRTA 2ATEA 3DXZA 3TLGA 3T9FA 3ZSOA 4MDFA 1YQ9A 4CETA 4NGBA 1DRVA 2IY9A 4HI0E 4HDNB 2ID7A 3P7MA 1LLQA 3RIXA 3OTWA 5C8ZA 3AOEC 4ITUA 1GCGA 2Q62A 2XAAA 2ZPUA 4YRRA 3ZPXA 3AVUA 2FN4A 3KOMA 4G23A 1Q0SA 3P0FA 4JH0A 3FHLA 4NQZA 1SA0A 2JFWA 2OAQ1 3WS7A 4CJUA 4OQPA 2VDRB 1ZITA 2AEEA 2PZLA 2PH1A 3G1WA 3V9XA 1RZ3A 4KI4A 2YNMD 1FP6A 3F49S 3ZY6A 1RDCA 2GWKA 3EDYA 4JK8A 2H63A 2RONA 1BIFA 2QG6A 1HE3A 3TEMA 3L6OO 4B3HA 1NLMA 2DWOA 4M7RA 3OYLA 2HEIA 2F1IA 4TMKA 4X1YA 3TZ6A 2DHRA 4EAAA 4YT4A 5C46F 2FY8A 3L7CA 4DSEA 1CS0B 4FGJA 4ZI3A 4FOIA 3UK0A 1M34A 3OAAD 4OOFA 1RLJA 1PT9A 2Q7XA 4LGVA 4WECA 2QA4N 3D2AA 2D1TA 4B7CA 2O5RA 1XMQB 1FTNA 4P35A 3Q85A 4D0GA 4E5UA 3I2FA 1X7WB 3GFTA 2PSEA 4NLCA 4BUJA 1V37A 2GTPA 2FLVA 3E48A 3HKEB 4LE2A 1WZIA 3PNVA 4QDJA 3ZJVA 1UKAA 4ARZA 4P58A 3AO3A 3IVRA 1VPVA 3OYCA 4PSKA 4E46A 3RIEA 1P17A 1OT3A 2ETVA 4QUJA 3RJZA 1P1HA 2CL6X 2FSVC 3KR9A 3O0DA 3ZGXA 1DWOA 4DMUB 4TQGA 4CLOB 2HY7A 3DDCA 5T41A 4RQAA 3A1SA 1KO5A 1XHEA 3EF0A 4MW4A 4M0LA 1DZIA 4Q82A 4R05A 5EOYA 3RYCA 3LUCA 4RHTA 4K9SA 1EHYA 1JLLA 2FC0A 2FN7A 1QZTA 3P2OA 4GKKK 1FPMA 4PQYA 5SY9A 9LDBA 3T1TA 3EIQA 2OV3A 4J7AA 5CB8A 1QBKC 2R5WA 1J53A 2IVPA 1C7ZA 1N6PA 2JJ1D 1B3BA 2VT6A 3LXXA 3T06B 4JL5A 3S5JA 3FMGA 3GFGA 3K6SB 4DYDA 2CT8A 3IKTA 5BV2P 1RYDA 3A5LC 4A61A 2GXQA 3M4XA 4M63C 5J3JA 4G0MA 3WRYC 2P9KB 4ZICA 4FJKA 2ISCA 1O5OA 2ZUFA 2HHQA 1QZ3A 2P3LA 3BRWA 3GRUA 3I5MA 3TR0A 4C0HA 5EIBD 2ZZKA 4GP9A 5AVTA 3QERA 1MX1A 1PZMA 3F98A 3OQMA 3WGJA 2C7RA 3DT6A 4OTZA 2ZJFA 2VATA 4Q4CA 1OBOA 1VL1A 2QRVB 3N9IA 1G7SA 2VDNB 3ENZA 1OW3B 5FLYA 3VU9A 4FINA 2V58A 3HDYA 4KYUA 1B92A 4ZYYA 1H05A 2A5XA 3IIEA 4PTYA 1WPQA 2RGWA 4K0KK 3L05A 2PLRA 2QPOA 4IVNA 4F92B 2PFKA 1VJTA 4ECEA 1BWRA 2Z3ZA 1T3SA 4A2CA 1Q0TA 4JB3A 4F5DA 5AUQA 2WQ6A 2BSXA 4CCYA 3DMPA 5AICA 5F2NA 1XX6A 2G1AA 1NOZA 1OF1A 3PBKA 1MG5A 3GDFA 3MTAA 4M9CA 4DTUA 1STOA 1FJHA 4DJTA 3QUAA 3QFSA 3NU1A 4RZHA 3MWDB 2IDZA 2VOJA 2AFIB 4PVDA 4JI3B 1YACA 3LCJA 2ZRCA 1BHJA 3JRNA 1BQEA 3QLTA 4W5HA 4YJHB 3ZHYA 3BERA 3I5XA 1X39A 2YH2A 4L27A 1JHVA 1L5OA 4AF7A 1EK1A 4NH5A 3L1UA 1I4WA 1UAAA 2JCSA 1XHFA 5CT5A 5E0KB 3KQHA 2HA0A 3B6EA 3E1YA 4BRDA 3IBTA 3UKRA 1YCHA 4W5NA 2H85A 3NTXA 1T6CA 2XEDA 1KP2A 2G9UA 5GQSA 3W1WA 3EEIA 1UBMS 2P1RA 2VN8A 2VRNA 5LLSA 4BKQA 5EMJA 3UMSA 1FP7A 5KCZA 2Z9DA 4FM9A 1CJSA 4V1CI 2WK1A 5DSTA 4J6EA 3R9XA 1QZ5A 4I4TA 4C6TB 1PWEA 1Q0QA 4HLCA 4IHJA 4M38A 1OAOC 2YS6A 5AWFC 2RI1A 1Z8NA 3SIRA 5FRMA 1RWMA 1ZUD1 3L6UA 2UVPB 3D7EO 3LPAA 3G10A 2GB4A 5BY2A 1G3RA 2R1TA 4EYGA 4H5NA 1YRHA 3R3LA 1AGXA 1FK8A 3C6QA 2AUTA 5TGDA 1GT6A 4MKZA 2Q3FA 2JBHA 4Q4DA 2CHQA 1A8SA 3MK31 4PX2A 3PQCA 2O2GA 1QVVA 3CR8A 3L4EA 5G3YA 4HNGA 2Q1TA 2NADA 4DQKA 3G79A 1ZJ4A 2E2WA 5GIPA 3E2PA 2P9KA 1OTYA 2OE2A 3GRAA 5DM7L 1IM5A 3FCOA 3HU3A 3AEKB 1KEWA 1S1XA 1U9IA 4MUJA 3F90A 4J7UA 1PGQA 4PHGA 2IEYA 5ECYA 5FWDA 1N1DA 4PONA 3FZQA 3DAGA 4GBGA 4IILA 3BSYA 3ZQKA 3RUHA 1FFHA 3COVA 5ICGA 1E1LA 3DKVA 1U8TA 1RACA 4ON9A 4AYXA 2SKEA 4YMWA 2JC3A 2R1TB 2WP8J 5E6SA 1KJZA 4BRFA 4N9QA 4YJFB 1MAHA 2ZT7A 1XRJA 1Y9AA 3LQ1A 5B1SA 2ZIFA 4HB2A 1EXVA 2CDBA 4WXEA 5IUNC 2XY4A 5L3QB 3LF2A 1K3FA 2QVGA 3FCEA 2IWHA 1LWFA 2V1UA 4I4TB 2R48A 3STVA 1V3QE 3JRXA 3NAQA 2VUIB 2I55A 2X5XA 3K1AB 4JU9A 2D4HA 4YAFA 4Q9AA 1AE1A 1CUUA 2I87A 1ZC4A 4GOXA 1GUBA 2HHSA 2AOTB 2J6HA 4BB5A 4OHYA 4F2WA 1KFSA 1KJ9A 1U5BB 4TYQA 4IGIA 3ZN2A 4CJRA 3H4TA 5ABPA 3DM9B 5KQ8A 1X9SA 2JFVA 3M4YA 3GU3A 5MF6A 1XV5A 1A7AA 1GTZA 3MSCA 4PNPA 5IC5A 2BCEA 3UOAB 3VC2A 1HKGA 5BN3A 3GR6A 4W99A 4Z0TA 1NBHA 5KSYA 4FSHA 1ULTA 4CF8A 3PDCA 3M8QA 4KJXA 4U7TB 4DLZA 3A2KA 3EAFA 3WGHA 1SKYE 4RIFA 4RH3A 4PO3X 3L41A 3AY7A 4CM1A 1YJNN 1U04A 3L3UA 1Z56C 1QE5A 3AHCA 4G1BA 4YX9A 3PFGA 1TJYA 2XADA 3BKXA 3V1RA 3DE6X 1SBIA 4M0KA 2OZPA 5L3SA 2OYQA 1XI2A 1FNNA 1IXZA 4LE0A 1GNVA 5LL6P 3CG4A 1S1WA 1J0BA 5GINE 4DM3A 3BWCA 3ELUA 1TUUA 4MICA 3P2JA 4BVPA 3UMGA 4AJLA 3KKOA 3NF8A 5EVJA 2CMKA 2FUG6 3O1LA 3V8PA 1N34B 5LJVA 3U4CA 3WIUA 2DRIA 1UC8A 3ICPA 4JS5A 4URUR 3Q5EA 1T9GR 3QMPA 3G8BA 4HAOA 4JEIA 4CL2A 4QGFA 3TW8A 3SS8A 2X9QA 4RFSB 2F8LA 2WJVA 3ZGNA 4O8ZA 1IJKA 4YI3A 4CZFA 3E8MA 3IRUA 1G21E 4WXHA 3H5NA 1MWMA 4QYTA 5BNIA 1NWKA 2CE7A 2JJ2A 2B5JA 2ZB4A 3MOIA 4ZZ2A 5IJXA 5K6RA 4C7OA 3HYFA 1IDOA 3WLSA 5HRPA 2OP1A 3C3JA 1KMHB 4EPTA 1FJ2A 2ZGVA 3PQFA 3LC0A 4XYLA 1GTJ1 4A57A 4I7EA 3GCGA 1GU1A 5E84A 4J1NA 3NT2A 4RQBA 2C4KA 3PNOA 3FGUA 5EJMA 1D4XA 2I3ZA 2NRXA 3EQ6A 5JG7A 1GU0A 4L51A 1QVAA 4OFZA 3RYFB 2XMCA 4KBGA 4L5IA 3I30X 4XCQA 1U47A 3CVVA 1CRLA 2R751 2HSEA 3K0FB 5LXTB 4M3ZA 3TAXA 1RHRA 2R6CA 1ZRNA 1M6WA 2VP6A 3UW1A 2WUFA 4XSHA 5JAHA 1ODLA 1NK4A 4U7WA 3RMCA 3BE5A 3BF1A 4ATNA 1JF8A 4J8PA 4LRSB 5AW8A 2GOYA 1E58A 1GQYA 3DVQX 1PJSA 1ZSNA 3INGA 4MQ4A 5LZ7A 3R3ZA 3W6ZA 4YQFA 4H5RA 4Z9FA 4CTOA 2PKEA 2X6NA 1P7WA 2WJWA 1S6PA 1NSTA 4KLCA 2EDAA 3DE0X 3F46A 4PC1A 4D9IA 5ITZA 1V25A 2CZQA 2HHWA 2O3QA 3M9XA 3MTEA 2I80A 4JJEA 1AOXA 1L4UA 2EBHX 4GKBA 2P6OA 4HRYA 4M0CA 2PX8A 2X7JA 2D59A 2VH1A 3SZUA 1Y8RB 1NF2A 1T6YA 2CVOA 1ZZEA 3ESQA 4C8NA 3LRTA 2MDTA 3M2PA 3PF9A 5AK3A 3WX0A 2Z98A 2JFQA 3ZWDA 4LXIA 1UOQA 1VJ0A 1VI2A 4FWQA 3ZCPA 2DLCX 2VTVA 2HPAA 4ENPA 4H0VB 5A4JA 3KQQA 1PNRA 3OE4A 2Z5LA 3VVMA 3ZU5A 2DFHA 4ZKDA 5LQKA 4ZTUB 4Q7MB 1SD1A 3DA8A 1M9NA 5AQRA 2QAGA 3D54D 3TTTA 5EN4A 4D6PA 4EJ0A 2Z6UA 3A6PC 4ZI5A 4JI3K 1DS6A 2FN3A 4X93A 4UQOA 1WCWA 2G71A 1F7UA 2ZJ2A 3LFUA 1FVHA 2AF3C 2BI7A 5FNVA 3VQTA 3DE1X 4RV5A 3E81A 4XQ9A 3ZHUA 4I5FA 1NMYA 1F3LA 4W63A 1Q5PA 2WTEA 3AR7A 4DCCA 1RI1A 3GROA 4CV3A 1E8DA 1RM5A 3GJ8A 3OLVA 1NC3A 4NR0A 3D6RA 1A98A 2B5OA 4M1EA 2PUVA 3MBOA 3MTIA 5LBIA 5TPZD 1KEVA 1NQXA 1WBDA 5DOZA 4OQYA 3TQQA 2ODNA 4QU8A 4M21A 4DIFA 4XD7D 4US1R 1F12A 2QMEA 5AQZA 3O92A 3WY9A 1EZ4A 5EJGA 2RJ3A 2XZDA 4J0EA 3MPUA 2IAJA 4PG7A 3R7LA 4NU6A 3UT6A 4S3MA 3L0PA 3SHTA 1ODJA 3OIVA 1IQPA 5CDFA 3E2MA 5FBQB 1EFLA 1NJIO 1Z16A 4B4DA 2WOJA 1FNCA 3B70A 3SVZA 3VVBA 4C3OB 1BSVA 3AW9A 3SSMA 2GK3A 3PXAA 2ASEA 1U6JA 1XZHA 1MO4A 4IDAA 4IJUA 4HH3C 4A2QA 3FY4A 3AM5A 1JKIA 5PNTA 2DETA 3QE9Y 5HGXA 3SJJA 2NZTA 1QO0A 4JQYA 4TMXA 4C22A 1NMQA 3NHZA 1B0AA 3VPHA 2QTRA 4EG6A 3D8BA 3WBBA 5AVOA 3IQWA 1HDIA 4JI6B 5I7FA 2L2QA 4CEAA 4YMLA 5IDWA 1Y5LA 3SBGA 4X66K 1W96A 2CF6A 2DWPA 1CWUA 2A92A 3E22B 3IUMA 3D8UA 4OHXA 4OK5A 5EUMA 3OFND 2ZE5A 3GUCA 4KHQA 3QEAZ 3D3KA 4MS1A 1U8EA 4BEWA 4BNMA 4H7FA 1TU4A 3R6GA 1MR3F 3K9GA 1E89A 2E37A 2VLBA 1TLTA 1XD2A 4KXQA 4ZEVA 5DEIA 2XNKA 3T95A 3O82A 2VJAA 3BWYA 2DFPA 1F20A 2XOKD 2H8GA 4OKNA 1XLUA 2WYIA 3EDRA 2JGRA 3UJ3X 5ITSA 3OEWA 4FNOA 4WA8A 3ZDYB 2QAGC 4EH1A 1AZWA 4INOA 4LDRA 5BUZA 1SXQA 1LPNA 3TTUA 2AOUA 4BNTA 1H2FA 4U2EA 3FR7A 4D3ZA 4FBLA 2HYIC 4NS1A 2RH8A 3CVYA 3ANSA 5IXJA 2UKDA 3GMDA 1KF0A 3LXMA 2CJYA 3QWHA 1EDDA 5JAMA 1W6RA 3SC2B 4S1PA 4FYMA 4JD2B 1JIXA 1JLKA 2D8AA 1U1IA 1M33A 3DLTA 2LV8A 1TEHA 2JBAA 4G5XA 3CH5A 5CK5A 4EHKA 4Z54A 3TQFA 4HRVA 4V0NA 1TVEA 3WAJA 3ESZA 3H1VX 2ZSAA 4DLRA 3OOHA 3FHOA 2GUIA 4IINA 3NVAA 2AHRA 1XO1A 3WLMA 1DCTA 2MSEB 3SFZA 2O1SA 5JAQA 4B75A 3CS3A 1UA0A 4MVYA 3OWOA 2OSBA 4HWTA 4TWAA 4EYSA 3NFAA 1JEDA 1EHIA 1X42A 4FPAA 2NVUB 1XLWA 3GLVA 3P9YA 4Q7LA 4RGYA 3ZD9A 1JEJA 1X8KA 5C8XA 4MW2A 5J2UF 1U1CA 1TF2A 3EZ5A 4FIDA 3UJ9A 1C50A 3QXCA 3A1UA 3IMFA 5DLPA 2VHEA 1K2WA 3ZW8A 5M29A 3E6AA 3PENA 1E20A 4DMCA 1MGOA 4Q4AB 1CUAA 2MINB 4BDTA 1LBTA 3DB1A 3GIWA 4UU0A 5KDLA 1H1VA 2RGDA 1DJNA 3IP9A 4IJVA 3KZOA 4NE7A 3N7AA 1NYRA 3I8SA 4KUGA 3S3MA 4GV6A 2C5BA 3SZOA 3JTEA 4O2AA 2JWLA 1EFPB 2HIMA 5AOBA 1NGAA 5FPTA 1FFAA 1PEKE 2O50A 4EP4A 1W0KD 1IPEA 3AHIA 5CNJA 2F7TA 3CC4N 4FK0A 3ETJA 3I53A 1ZMXA 1OLUB 4L16A 1GLAG 3M8SA 1ITGA 1I33A 4UHJA 4PNEA 1NI5A 2JS7A 3H05A 5C51B 2QE7D 2E4WA 2VG7A 1XZIA 2JZNA 4IS2A 4R3UC 4FT4A 4X6UA 1P1KA 2C7OA 4B1FA 3QEWA 1BCRA 2IEDA 4LOLA 1NK5A 1V2GA 2P5GA 1PO7A 2EERA 1BA2A 2P30A 4FLFA 1O6FA 1MAVA 3SPZA 3F6BX 4ZMSA 3QJ5A 2QY6A 1U3TA 1ND6A 3V6DA 2YXEA 3A8TA 2ZUBA 4DLYA 1Z28A 5AJZA 1UBJS 5C53B 4QIHA 4HVJA 4MWTA 4WQ5A 2FOXA 1IBLB 2OESA 1R0YA 1HO3A 2A6AA 2G9VA 4NOKA 2HLDD 2XB8A 3C24A 3GOHA 4L1UA 3RRGA 3ZDQA 1R9NA 2XWJI 3HXMA 3CLRC 5KNBA 4PBRA 3WLJA 2NVOA 3UXMA 4B85A 4D74A 1XYGA 4YECA 1WG8A 5KNCA 2XI4A 4NOLA 3TH5A 2WKQA 4BNKA 1L4KA 1QR6A 3AO5A 2HHXA 1QAQA 3M1YA 4H3KB 3BJRA 3KVNA 3LZDA 3R3SA 1OIXA 4YRLA 3K4QA 3V4SA 4DXAA 1RYBA 1WMAA 3BFPA 3W34A 1QC5B 4NRDA 1GKIA 1C30A 4KR7A 3FYTA 1ZQ1A 2AJQA 2NLXA 2OG1A 1E7RA 1KO1A 2PEZA 1DAKA 1FBTA 4BQPA 2BFCB 1JFSA 3AUSA 3RMDA 3RC7A 4I55A 3N59A 4RY9A 4B84A 4C0KA 3R23A 5DYGA 1JVBA 2JGUA 3IVAA 1CW2B 1NR1A 1FX0A 1A7JA 2BHRA 4DREA 4DIKA 1C4XA 1ONPA 1H4QA 1VRCA 2G76A 3BH6A 4R83A 2I5JA 1J1IA 2ZYGA 3CUVA 5AQOA 2HMWA 3B8EA 4QGBA 4LOIA 4QPCA 5IDVA 3KXDA 1NOJA 3L92A 3EKUA 3OA0A 4AQYK 5J1EA 2HDHA 4KDRA 2V7TA 3IKMB 4Y2TA 3ZU3A 3S40A 3TTCA 4HDMA 2CL0X 4YRSA 4GOKA 1RT7A 4DDKA 4QU0A 2J9ZB 2Q4RA 3L8YA 3Q11A 1KVUA 3U44B 3VESA 2C9BA 2EW1A 1M1KO 5HCIA 4X94A 5CFPA 3WT0A 3U3YA 3IKJA 4P3NA 2QJWA 2KBFA 1NUAA 1LPSA 2DGDA 3IP6A 4PNZA 2CH6A 2QMYA 1JDUA 3HFSA 5K3AA 4MSUA 1U3UA 4C29A 2V51B 3QICA 1QV7A 5G4LA 4DANA 2GAFA 3F73A 2DBYA 5J4VA 3UZUA 4M60A 1JNXX 3AJ8A 1DJOA 2RJNA 5CB4B 3O38A 2IYQA 2B8NA 2PXAA 4BVFA 2VQFK 3L6QA 4K81B 4E07A 2B3DA 1WY5A 2N1MA 3OE7A 1N7JA 4YNQA 3RHTA 1Q7RA 5GJWC 5EHNA 4B2PA 4YRGA 2UZAA 2A30A 3CH4B 2YXBA 3LFTA 1K9MO 4ZTBA 5SY4A 3AFNA 3E7XA 4HNSA 5DHSA 4PKGA 2C4NA 3E9YA 4MMYB 2VWKA 1BN7A 5GVSA 4ZD6A 2YX6A 4HC4A 3U6FA 1P39A 4RK1A 2FG5A 3SN6A 1H4SA 3HUUA 4H7DA 3TPZA 5J4LA 5L9AA 4EHUA 1NVAA 1DDGA 4X71A 4BMDA 1U31A 1BWQA 4YT5A 7AT1A 2P9LA 4FFPA 4UNIA 4PG8A 1SM4A 1NN1A 3HY4A 4I1YA 4KFTA 4JKCA 1Z13A 2NYAA 3DEAA 3JTMA 4YNBA 1YS9A 5TC4A 3VPFA 2VWBA 4CJWA 3M4ZA 3ZLUA 1C0GA 2RBEA 2CBXA 3PE3A 2JAXA 5KVSA 1GG9A 1A2BA 2QD5A 2AWNA 2H2WA 3BRWD 3EYZA 3HMKA 3JZMA 3PXXA 3UUEA 2XTAA 1LDMA 3N8NA 3PFNA 5KJCA 1FTWA 1NI3A 5DHUA 2JFUA 2J5XA 3GG9A 3LLSA 5IT5A 2XMSA 2FF5A 2E7ZA 3C97A 2YCLA 3CLSC 4AZVA 3ER9A 2FR0A 3AWIA 1E2LA 5EP4A 3MLAA 1ZA1A 3B6PA 1QZUA 4DTXA 4O55A 2JIZD 1DO8A 2H2GA 3CRW1 4MDBA 1Q16A 4NENB 5KJ1A 3HCDA 3AVHA 3BIWA 4MW7A 1VHJA 1X80A 1LFDB 2ENWA 3DCNA 3FD8A 3IEXA 1ZU5A 3ABZA 1L1FA 4LFAK 3FOEC 4JDUA 1A3CA 3K0CA 3LTEA 1GGEA 3DWIA 3RUDA 1MOZA 2LKCA 1IJEA 3BDIA 3E5MA 3RQSA 2IITA 1EE1A 5B2ZA 2FMTA 5EJFA 1XZLA 2K2WA 3PLAA 2XJ4A 5ECDA 4UTNA 4OQQA 3BEXA 3SQ0A 2AMLA 2H00A 2X2OA 1JR3D 3AETB 3E0XA 1W2HA 3MAGA 3H0EA 3FZEA 4KDCA 3DT9A 4UE3S 3QBWA 1E92A 3U56A 1Z63A 3S3TA 2D5LA 2H6EA 3GG2A 1VRVA 1PHPA 1XLVA 3KSMA 4N39A 1LK5A 4BXOB 1YS1X 4EQZA 2YVKA 1W1UA 1Z0AA 2B69A 3CGWA 3FUTA 3I2JA 3AUAA 4LKOA 4NZYA 5C31A 3E4DA 1YUMA 4NX2A 1Z4KA 1GU7A 1X8XA 1L4BA 2CK3A 2EWVA 5CHYA 10MHA 2K6GA 4LTNA 3H8VA 1PJRA 5I3UA 2QN1A 4NARA 4IJQA 1EMDA 1YNSA 4J0GA 1GOAA 4AHTA 3GHYA 2VNIA 1HGXA 1ZN2A 2FPPB 3BH7A 1G5TA 4LYJA 4PICA 3UT5A 4C7BA 3PHHA 5MLCQ 3RTVA 4HF7A 2QNRA 4V3CA 3AVWA 2Z4TA 3KT6A 3JVVA 4ZYLA 1CB7A 1S89A 5AQIA 3TECE 2BFPA 4FD3A 3NRBA 4TTSA 1MA0A 3EQ9A 2HBZA 1JMKC 3QXXA 3HUDA 1XMQK 5KVQA 2D1RA 1J56A 2POCA 2RFLA 2X86A 5GAGP 3B52X 2H7XA 3NPAA 4JVMA 3MHTA 4QX6A 1KH2A 2HWKA 1CUGA 2IPXA 3VR4D 4JQCA 1W4LA 2UYCA 1XA3A 2FXUA 4O44A 3MJ4A 3GT4A 3HABA 1DKNA 1WB6A 2F43B 3NV7A 1UPXA 4PW0A 5WRFA 3JPYA 4IGKA 4MYCA 4NYIQ 4MGHA 2J9GA 2QX9A 2E1PA 3TD6A 2MSWA 3EZXA 4CQMA 1M2HA 3STYA 1U02A 4L6IA 3AEZA 3L8MA 1L5ZA 4X62K 2CVPA 1TKAA 1MNAA 3HYSA 3MQFA 4OHBA 1EA7A 5K3CA 4C7OB 3HT3A 3PNPA 3EGXB 1OX5A 1Q50A 4L0DA 4DV4K 4QQNA 3RBAA 1KP9A 5IZCC 4RG8A 4BRCA 4FHCA 1WETA 3L3VA 2AA4A 4R6XA 5F1YA 3VGJA 2UUAK 1CF4A 3DMRA 3FFTA 3ZSQA 1FS6A 1SXJC 4H7PA 3V3KA 4MI6A 3ODGA 2BLNA 3AZPA 4BIMA 3BGWA 2H2IA 3C3YA 4TXNA 1CDOA 5EXPA 2OT3B 4X85A 5AHRA 1TYQA 4PO8A 3LPMA 1ESVA 3S1AA 4YFUA 2ZJOA 3TN7A 1A2QA 4F91B 1P0CA 1Z6QA 2WHRA 4X90A 1P60A 2P2ZA 2QWXA 4J0HA 3HVRA 5REQB 3THRA 3VJRA 1D4OA 3CFRA 1N9ZA 2IYLD 2NQ2C 6LDHA 4TLEA 4PL7A 1XKQA 2G8WA 1K6EA 3IUSA 2VNSA 3K2QA 3O6VA 3EEQA 5GJCA 4F4UA 4RW7A 5HMLA 3EZ6A 4WYBA 1KA9H 3SC6A 2ITMA 4X7BA 5LWHA 2Y1JA 1QHSA 2VJMA 3R6WA 4I6GA 2ISQA 4CZMA 3OIUA 4CJ5A 4LXQA 3OJUA 3ASUA 5ALNA 5A9SB 5BW8A 2MYNA 2I6SA 1KJYA 1LW6E 1ZK2A 2UXDB 1RLTA 2EQBA 1DLOA 4OPHA 3GJ7A 3WMXA 5LDDC 4H60A 1KVBA 2GKSA 2CB9A 1D5AA 3OCYA 1OI7A 1SY7A 3KKQA 3HL4A 2A0YA 4UHBA 3UXEA 5BN3B 5AW4A 1PFUA 2I0FA 1W36D 4TSKA 3QVLA 1AQNA 1FRVA 1Y8QA 1S8FA 2VTBA 2D0OB 3ZGZA 1QYCA 3E7WA 3HCEA 2GELA 2R96A 4N0PA 1ID8A 3QKSB 3K0HA 1W76A 2FOIA 1OFIA 2ST1A 2ZB2A 3AHHA 5AQKA 3HCOA 4PSAA 2EP5A 2RPIA 5FFNA 3IURA 4O33A 5FWAA 3DF9A 4RAOA 1SHKA 3MELA 3K5OA 2DH6A 5E95A 1T4MA 3GDHA 4E09A 4KHNA 3DM5A 2HHLA 4IF6A 4W5TA 4ZTJA 1EB8A 2BFWA 1OXSC 1H93A 1L7RA 1QIKA 3DTNA 4M1MA 5DNDA 1K6IA 1AS3A 2O5VA 3M9LA 4PANA 2J32A 2IIVA 5FTLA 2CF5A 2C0CA 3GPDG 2C4HA 5U9CA 5M1OA 4CJ3A 1DT5A 5JBIA 3UMMA 2BCGY 4LVOA 2PUDA 3KEFA 1LRLA 3BTOA 4BVAA 4U7BA 1VL0A 4LHYA 4TSRA 1AS2A 2Y1KA 2G0NA 3P9CA 4H08A 4ZCMA 2JGLA 4LD0A 3N0WA 4P83A 4KR9A 2RHLA 1XALA 5ED0A 3HGMA 5F78A 4YYZA 1AXEA 2NZ8A 3PJRA 2FQ1A 2VJQA 2YHYA 3H7AA 1H5UA 3K92A 1ADJA 2X1LA 1IZ0A 4R5PA 1E2IA 3NTRA 3HHEA 2O2IA 4HAZA 4AWBA 5FL3A 3WZLA 1GY8A 1D9FA 3E1SA 4I2NA 4F6CA 5KTMA 3D2EA 5CIYA 1N1EA 1XE3A 4ND1A 1OI4A 2BMJA 5FFFA 1TTPB 2VSYA 4DBLE 3TINA 4PPNA 3DAYA 2VHCA 1CY4A 4DT1A 2YNMA 1T0IA 4EHDA 4JQSA 5JAIA 3V4ZA 4X7PA 3IQDB 2IYWA 4MLHA 1FRNA 1RFQA 4I55F 5L51A 3G2JA 5JS6A 3T3PB 4CMHA 1PYOA 2WB2A 3I62A 2WIAA 4MCAA 2YV4A 1XNGA 1WSGA 2H1FA 2ZRAA 4CMCA 1JU3A 2KWIA 4MUKA 2FXVA 4LKRA 2O8BB 3Q7RA 4YIKA 1M8KA 3CNNA 1BHO1 1RXIA 1Y4ZA 3HU2A 4B2LA 5I6DA 2A5JA 2Q5QA 3K0BA 3QFRA 3FTEA 5LYYA 2P5OA 1WDMA 2AS0A 3JYNA 3B1XA 3SYTA 1V16B 3RSSA 4NU0A 1JHXA 2OTJN 3MWDA 2R6AA 1WSHA 9MHTA 1J07A 2Z1NA 4IOMA 3CMEN 1QV6A 1JHYA 2ZR7A 2VDWB 2IQ5A 4PGMA 2FPGB 3CFYA 2NO5A 4V0KA 4ZV4A 3E84A 5K3EA 1F8YA 1Q1NA 1C9JA 2H1OA 1REVA 3UJDA 3TXAA 1YA4A 4QQFA 2ZCUA 3PJDA 2V6GA 2MSNA 2DEUA 2ZCJA 5SYNA 2FWRA 1Q57A 4ZIRB 4QFCA 1O96B 2AFHB 3NAEA 3CMAN 3ANNA 3LDGA 4EGCB 3EC2A 3Q3VA 4Q4HB 2HX1A 5K8VA 2G70A 3PD1A 5DGCA 3V8NA 2PFGA 2ID9A 5B53A 1ULSA 1R64A 3ZH2A 1HKCA 2HO5A 2O1WA 4WE3A 5SZJA 1TQ8A 2VLIA 1GDTA 2Q9AA 1AURA 2PZKA 3FZNA 4FYYA 4J3FA 4FXDA 1N8KA 3AL0C 1FFXA 3KJHA 1T0UA 4LPSA 2D4AA 1H4TA 1NHGA 3DYIA 4G5RA 4LAFA 3FZGA 5IKMA 1LPAB 1O94D 3IPLA 1HNZB 1RBRA 1DOHA 2BKXA 3FR8A 2REBA 3I6BA 1OFGA 5D8DA 1TA4A 4OLAA 3S2FA 5BVGA 3F2VA 2NTEA 4ZT4A 2JFGA 4LDJA 5A5FA 4WLFA 2YBDA 5ALEA 2QRQA 1N2HA 4J0DA 1BO5O 1IHUA 4LZNA 3ZE2B 4DDHA 4Q4JA 1VIVA 4W5RA 4EOGA 1WXXA 4BGAA 3GDOA 5LOVF 2IE8A 2B8WA 2QOEA 3ISNC 4Q00A 4ZANA 5JBNA 4CD1A 2NU6A 4H35A 3R0IA 3CUSA 5IBRA 2QL7A 3EIXA 4LF9K 1AS0A 1E3DA 2VHTA 2RHMA 4P86A 3R7WB 4A0HA 4CLOA 5KO2A 4NKRA 4B3RK 4KHZA 1PR5A 4OX9B 1XTTA 2IYNA 4OQEA 1OBHA 3WNBA 5KBYA 2V6IA 2XPCA 1RQLA 3G7NA 3G5TA 3ORSA 4UXHA 2PYZA 4JMLA 1J0XO 4MYHA 4QBHA 4G5FA 4GX1A 1C1XA 1NY5A 4JITA 3BE4A 4Q19A 4QOHA 3ZNQA 3WNFA 5FLXO 2W9XA 2VWJA 1MP0A 3G85A 1TZKA 4KTVE 5CBKA 3NDBB 3ORYA 3VR6H 3OZVA 1WLJA 4TXLA 4CT0A 2E89A 3LPNA 2O3TA 5I5EA 2HNZA 3VQCA 1KQOA 1LKZA 4QXQA 2V9ZA 2QK9A 4MRMB 3W9SA 3DJCA 1L7AA 3BMNB 1QQMA 3HM9A 3KR1A 4MYDA 2ISSD 5EIFA 1DB3A 2PS0A 3C3MA 4K5QA 2ZWAA 4CR6A 5CUQA 1MDBA 2QI9F 1G8SA 3C94A 2YJTD 3ONEA 4ILEA 3NI2A 1TM1E 4IBOA 3AHEA 5HRCA 3JQ6A 3I1FA 1KLMA 3ASZA 3Q40A 4IHKA 1NJYA 4MR7A 4Z4GA 1E1DA 3GNLA 4AT1A 2W2NA 4J2HA 1T1JA 3IFSA 3Q7TA 3TLXA 3ZEUA 4ZP1A 1UFOA 4R7TA 3QPDA 3HM8A 4M0FA 4WBNB 5K2OA 4ICIA 4WINA 5C80A 1S9GA 4HCCA 3PHLA 3IT3A 3QNUA 2X5JO 4P22A 1GDHA 1R10A 3K9QO 3COWA 4JUAA 4HUGA 4C0SA 1P2FA 2NO1A 3T1YK 1GCIA 4NY1A 1SVUA 3BDVA 3H1TA 4JASB 4JSRA 4U9UA 4WNYA 5A4MS 1LQ2A 4JLMA 1NW7A 1XDUA 4QICA 1XAIA 1WHSA 3N8HA 1T35A 3O9SA 3PJEA 1W6UA 3BZCA 2IEGA 1A2KC 4O02B 3GRZA 5KCMA 3EXAA 4DU4A 1ZX1A 3K72B 3T15A 3C7TA 4AH9A 2ZYVX 3MWKA 3UICA 5HKBA 5B4UA 2ZT5A 4X20A 4YMIA 1PW7A 4ZI7A 4JN4A 3CISA 1SQ0A 3ND7A 3WIOA 1D8TA 4DQDA 3ESYA 3FPBA 4LV8B 4MKGA 4NYJQ 1H2RS 4CHZA 1V9LA 2V4UA 3K9BA 5F64A 3KJIA 2YHBA 1M67A 3MYRA 1VA5A 3GLFA 1C1AA 4ZTZB 1OROA 3DV9A 1LBHA 3ZWWA 1PKXA 4I9HA 1RI2A 4U1RA 3ZR4B 1YZLA 2W7TA 3EA4A 5TE9A 2DPMA 3WNDA 3ZW7A 4D1YA 4DSFA 1N0WA 2X0RA 1SI3A 3LHFA 3ROEA 2WLSA 3U44A 4FYXA 5FTJA 3USES 3PC6A 2GHRA 3K09C 4LF8K 3ED1A 2HLDA 3WIEA 1UINA 3DBOB 4RADA 4TUYB 2I4NA 3WISA 4Z9BA 4B3JA 1VCNA 1JSXA 4EY5A 4S24A 3GFQA 1DQRA 2I9PA 4Y2XA 3RIGA 1P90A 3A3YA 2B1GA 3FCCA 4IJ6A 4WKOA 4COKA 4GXRA 2CJWB 2HSDA 1F2UA 1DKRA 1ODIA 4KAZA 1UPFA 4IGAA 3UHAA 3CBQA 4C76A 2E5FA 3CEHA 3FWKA 3V4LA 2YIDA 4CE9A 3TZEA 3SV4A 3ANTA 2FEXA 4WOBA 5D5QA 1BFKA 2LPMA 2QPTA 1Q7CA 1Q92A 2JK1A 4RMNA 4IMJB 5EXTA 1NXOA 4LRTB 2VAVA 5GM2A 5TSDA 3EGDB 1UEJA 3FNBA 1HURA 4EHFA 2P9QA 3T19A 5IH3A 1V9SA 2R4QA 1GTG1 2CJPA 3AI1A 1RKXA 4TKUA 2IWRA 2YZNA 4BBJA 3N7UA 1HLDA 1SCBA 2OUIA 2ZG6A 4LF7K 3AOEA 1PVDA 3WNZA 2RKOA 2HA6A 1HRHA 3OZGA 3TMKA 5FPPA 4R84A 4PLHA 4ZAWA 2GV9A 1WSBA 3AEQB 4ZT3A 1KQGA 3L43A 3N2GB 4GMXA 1SVKA 3Q1KA 5CR4A 3OQOA 3TB6A 3HKDA 4XGIA 3RV3A 3JQGB 1XT6A 4XDZA 3W0LB 3NH9A 4CUJA 1YZTA 1RLOA 1RQPA 4UASA 2XCUA 3LOQA 5KYWA 4DR6B 1ZOLA 2BBOA 1BJRE 1E2JA 1LBEA 2IYZA 1LAVA 1WPXA 1G8PA 3KO8A 4BWMA 2BGIA 3AU9A 4ZOBA 2E55A 1TXGA 4RX1A 1FYFA 3R5KA 2J7KA 1BXGA 3NNSA 2RN2A 3RS9A 3ND6A 3L6RA 5AUNB 4J9UE 3L4JA 3TSYA 3HL8A 1Z5OA 3K9KA 3G2KA 5KQPA 4FNMA 2YJEA 2V45A 4HGNA 3UN1A 1JJAA 4DA0A 2DZDA 4Y9UA 5BR8B 3LL3A 4F60A 1VQLN 3REOA 3V4RA 4GUAA 1RXEA 1YJ9N 5GM1A 4RA9A 3IDAA 3HMQA 5A4IS 2PS1A 3QOFA 2NZJA 2A1IA 2REQB 4Q16A 3GUUA 4QYIA 4JI0B 2QWOA 1RR6A 4B1WB 3P38A 1AK1A 1FQWA 3ULEB 1CRZA 2AFVA 1T43A 3BHMA 3NHBA 4JL6A 3SR0A 4FUTA 1UC4B 4BBPA 5KTNA 4BZPA 4IJKA 1S3IA 2GEUA 2RI0A 3CW9A 3CE6A 3OCWA 3P2KA 4HH4A 4O2AB 4NZMA 1M2KA 4X3OA 3SC3A 2H2FA 2W00A 3KQTA 1TL7C 4UM9D 4LZJA 5F2KA 5SWMA 3L8BA 2JHAA 3FZYA 2BYTA 4GPBA 5ESXA 2HZBA 3EUAA 2EFEB 4Q93A 1GQFA 2A59A 4QJ5A 4YBZA 1ISIA 5HBRA 1EX1A 2Y1XA 1JXMA 2YQ4A 1M1UA 2E5LK 4RORA 5HZMA 2ZGYA 3PSHA 1JQBA 1VIDA 4OGWA 1MB2A 1FA9A 4OB6A 5TRTA 3ZU2A 2UYHA 4TZ0A 4B5LA 2TMGA 4Z4CA 2HHUA 2ECKA 2NU7B 2XVAA 2H7VA 4IIHA 5EU7A 5DYTA 3EVCA 2FW6A 3U6KA 4AN0A 1VSDA 1IOLA 1WEHA 3PX4A 2DHDA 4PF1A 1H1TA 3DXKA 3QIOA 4ILGB 4LDNA 1E2UA 1K8QA 1E5DA 3I9KA 1EFAA 4FEEA 1MC5A 1Y6FA 3PNLA 1CZRA 3DP9A 4B6QA 2I7VA 3K8ZA 4O5AA 1C2TA 2AVDA 5AZJA 4KYTA 5AK0A 1JDVA 1S1MA 4CU2A 3AA3A 3L4IA 1OYWA 3ENVA 5LKRA 1P5RA 3M6WA 2GCNA 4ER7A 1N3YA 5CCXA 1OHHA 3A10A 1Y6ZA 1UQRA 1F6BA 1RJDA 5CH5A 4X45A 3RFUA 5E6UB 1P1CA 3CZAA 1L5WA 4HQ0A 1MU0A 2IIBA 2P5SA 3FWZA 3P4XA 2O8EA 3EW7A 1CUHA 2XNDA 3UB4A 4G1FA 4D02A 4G9BA 5DN9A 1OV4A 1NLFA 1G3MA 4DGSA 4EY4A 5EE1A 3TAFA 1ZIDA 2VH2A 4TTIA 3S7TA 1SVIA 2CJXA 2DOKA 2X9LA 4E7OA 4EUKA 1Y8AA 4QAQA 2OA0A 1G5HA 1UC9A 4EUEA 3HVJA 4BQSA 3RAPR 3O8OA 4MW1A 3ZLVA 4AWAA 1CUBA 5JHHB 1U7ZA 1YB5A 3DNPA 4PXSA 2C2XA 2UU9B 2KLHA 1BU5A 2COKA 3HP6A 2AZXA 1T24A 2H48A 5JXIA 2JAWA 1ZZGA 5JD5A 2ZWPA 3H9QA 4BGBA 3LDFA 4I2VA 3SZGA 5EWJB 3BY5A 4R2HA 3ZGYA 4EBBA 2QG4A 4WWHA 5DO9A 4AZ3A 4E2WA 2KW4A 2R84A 3KJXA 4KKXB 4LHWA 3LX4A 4XIIA 3PU6A 5ES4B 4ZFNA 3PX0A 3KE9A 4J16A 3WRXC 2HK9A 4HN9A 2DSTA 4B76A 4QOGA 1EJ2A 3AL2A 4RZ3A 5C5CA 5I9NA 5DM70 1JAHA 1QGUA 3KD1E 3PEFA 5IT4A 2N3ZA 4CKBB 5EXDA 1TIKA 2NTYC 4JKFA 4P4TA 3CRRA 2Q0HA 4KXFB 5CCEA 4DF8A 3FFKB 2W93A 4B1UB 4CHOA 3D7RA 3QNNA 3KYDB 1XJ0A 3PWSA 3U4IA 3E0QA 4XIFA 3UAGA 2IYVA 4NAVA 1E1CA 1KHHA 2J31A 4DZRA 3ZBUA 5ELZA 3T1QA 1O6BA 1BQNA 1X2EA 4RA6A 2EBUA 5CNMA 4LFAB 1KDVA 1IG9A 4IQFA 1MO6A 1T36A 4ML3A 1HNXB 3I8DA 5IAAA 4A0FA 1U1DA 1OXUA 3LLUA 3SLGA 5AYVA 5AIAA 1MDFA 4TTTS 3C3DA 3QVJA 4K2AA 4QA9A 5GMOA 2GSDA 5JWRA 5B5SA 2ECFA 1UJMA 2Z09A 2PMFA 3GVCA 1LS6A 4ESHA 3VDRA 4RS3A 1J49A 2W2OA 3RBZA 2SCUA 2GPJA 3CH7A 4EG1A 4R9RA 5LDGA 4URYR 4YUXA 2JGDA 1KPHA 2CLMB 2VWPA 1GPBA 5KPJA 3JQBC 1PGPA 1KZ1A 1VKHA 5FHQA 4RULA 5SZKB 4NGGA 2FPSA 1N5LA 4LXGA 1U0JA 3H9GA 2VJDA 3H0KA 4KQEA 2QP3A 1QU2A 3P27A 3EZWA 3CCUN 3D2CA 3PI6A 5IBPA 4PN7A 3OHSX 4B6GA 1HG0A 4DFJA 3R7BA 4FLUA 3DEJA 3NBXX 5FTKA 4M2LA 3ZV4A 4O29A 2QT0A 2OBLA 1AUPA 1S2DA 4EI2A 5KVVA 2AG0A 1X7YB 1Z83A 1QFJA 3BXPA 3FUCA 3G2QA 1WUTA 3M9WA 4P1ZA 1OX4A 4GH5A 5K8IA 1B15A 2RCYA 2GBCA 3FHCB 4GWLA 4E2FA 4E3ZA 5CDUA 5BYJA 2OA8A 4X8MA 1DG9A 3CIOA 5ENDA 4Q24A 4B4KA 1X7XA 4KHPB 4TXHA 1Z7YA 1CDDA 1Z4PX 3WTBA 3BXEA 1Q0UA 4WUVA 3WWCA 4EB0A 2WZQA 3BT7A 4YXFA 3QVXA 2AJTA 1PE0A 5IAEA 1KOJA 1PSZA 4OJNA 1BL3A 3LAMA 4B9TA 4ESOA 2IP4A 2QQ0A 1YONA 5BR4A 2G1PA 1JTFA 1EM8B 2I91A 3IGFA 3JARB 4O4LA 4LHVA 3RR2A 3Q1LA 5K0JA 2OANA 1QIGA 2ODPA 1D2GA 5LMCA 4MJXA 1FTGA 1K5HA 1GLEG 2J0EA