5T7BA

Argonaute-2 - 5'-(e)-vinylphosphonate 2'-o-methyl-uridine modified mrttr guide rna complex
Total Genus 227
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively.

Total Genus
227
sequence length
837
structure length
802
Chain Sequence
FKPPPRPDFGTSGRTIKLQANFFEMDIPKIDIYHYELDIKPEKCPRRVNREIVEHMVQHFKTQIFGDRKPVFDGRKNLYTAMPLPIGRDKVELEVTLPIFKVSIKWVSCVSLQALHDALSGRLPSVPFETIQALDVVMRHLPSMRYTPVGRSFFTASSNPLGGGREVWFGFHQSVRPSLWKMMLNIDVSATAFYKAQPVIEFVCEVLDFKSIEKPLTDSQRVKFTKEIKGLKVEITHCKRKYRVCNVTRRPASHQTFPLQQESGQTVECTVAQYFKDRHKLVLRYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIRATARSAPDRQEEISKLMRSASFNTDPYVREFGIMVKDEMTDVTGRVLQPPSILYGGRNKAIATPVQGVWDMRNKQFHTGIEIKVWAIACFAPQRQCTEVHLKSFTEQLRKISRDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYAGLQLVVVILPGKTPVYAEVKRVGDTVLGMATQCVQMKNVQRTTPQTLSNLCLKINVKLGGVNNILLPQGRPPVFQQPVIFLGANVTHPPKKPSIAAVVGSMDAHPNRYCATVRVQQHRQEIIQDLAAMVRELLIQFYKSTRFKPTRIIFYRNGVSEGQFQQVLHHELLAIREACIKLEKDYQPGITFIVVQKRHHTRLFCTDKNERVGKSGNIPAGTTVDTKITHPTEFDFYLCSHAGIQGTSRPSHYHVLWDDNRFSSDELQILTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKRDHQALAKAVQVHQDTLRTMYFA
Loading diagram...

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

publication title Protein structure
rcsb
source organism Homo sapiens
molecule tags Hydrolase/rna
molecule keywords RNA (UVP)UAUAGAGCAAGAACACUGUU
total genus 227
structure length 802
sequence length 837
ec nomenclature ec 3.1.26.n2: Argonaute-2.
pdb deposition date 2016-09-02

pfam database annotations

chain Pfam Accession Code Pfam Family Identifier Pfam Description
A PF02170 PAZ PAZ domain
A PF02171 Piwi Piwi domain
A PF08699 ArgoL1 Argonaute linker 1 domain
A PF16486 ArgoN N-terminal domain of argonaute
A PF16487 ArgoMid Mid domain of argonaute
A PF16488 ArgoL2 Argonaute linker 2 domain
Image from the rcsb pdb (www.rcsb.org)
cath code
ClassArchitectureTopologyHomologyDomain
2.170.260.10 Mainly Beta Beta Complex paz domain paz domain 5t7bA02
3.30.420.10 Alpha Beta 2-Layer Sandwich Nucleotidyltransferase; domain 5 Ribonuclease H-like superfamily/Ribonuclease H 5t7bA04
3.40.50.2300 Alpha Beta 3-Layer(aba) Sandwich Rossmann fold Rossmann fold 5t7bA03
1S6PA 2D0CA 1P6QA 1U2PA 5EWJA 2CHFA 3O4QA 1JLGA 1WNSA 3TR8A 3FFTA 3LUHA 1SL2A 4EVRA 4C8KA 4B9TA 2FEWB 2E4YA 4OJRA 1YVUA 1S6QA 5KWSA 4Z9BA 1EWKA 3QIOA 3D02A 3D8UA 3GT7A 4FZZA 2A9OA 4KHNA 3SPYA 3HP6A 2RPIA 4DSIA 3L3UA 4WXMA 4H8KA 3H5LA 3ZT4A 3SM9A 1TJYA 1YT3A 2ITGA 4KTZA 3KLHA 3CZ5A 2QK9A 3CM6A 4CEEA 4DQDA 4CF0A 1T7PA 2V0NA 4DN6A 3TAFA 4FM2A 1L5UA 1Y97A 3T3FA 1FK9A 4CHZA 4LDZA 5CNKA 1DCMA 4F3OA 1ISRA 1PNTA 3H5OA 5KC8A 3ZSXA 3DGEC 1LWCA 4YFUA 3URMA 4E7JA 1TK8A 1ISSA 4CJUA 4NCGA 3TX6A 1BQMA 3DLBA 2F8SA 1WSGA 4N03A 4KTQA 3DI6A 5CY4A 1RDAA 4WE1A 3NBMA 4CHYA 2FEPA 5DLEA 4DS5A 2PE5A 1NXXA 3RMAA 3RR7A 3IAYA 4KZKA 3O6EX 3O4NA 4FLWA 3L2UA 2P51A 1BGXT 3BDPA 2XY8A 3I0SA 1RBSA 3H6HA 3A2FA 4CJTA 4KV8A 2XRIA 3JVIA 4KV7A 4EVSA 3I5AA 2JBAA 1ABFA 2JLEA 4RW6A 1RCHA 2H0AA 2QVGA 3ILYA 3O2QB 1FXXA 1NXOA 3HPHA 1WSIA 2YHBA 3DGFC 1Z18A 2PUEA 1U0SY 4ELUA 2KQ2A 3N53A 4YRZA 1BAPA 2B1JA 3QEVA 3S3MA 2QKKA 4LZLA 4CJKA 3HVRA 4H3HB 2E4ZA 4MR9B 1LWEA 3LUFA 4IMIB 1A2OA 1RT7A 4CEBA 3NHMA 3MECA 2QW1A 3KG2A 3ILHA 3AVLA 1TVMA 4F8JA 2ID9A 1I3AA 1VRTA 1JLEA 4RK6A 2HMIA 3OYEA 2M1ZA 5J2PA 3CFYA 3LALA 1RTDA 1S8NA 2YV0X 4PWDA 1RT2A 4CJQA 1QSLA 3SZ2A 1HQEA 1A5WA 3S3OA 2FSPA 2DY4A 3HEBA 2G8HA 4ETMA 4LH5A 3NGZA 2HQBA 3N0XA 4CHPA 1OXKB 3VQ9A 3M9WA 5HRPA 5JS1A 1IKWA 1PHRA 3E3MA 1BIZA 3DOLA 3E61A 1X9MA 2L17A 3AO5A 3HP9A 2X7XA 3QELA 2OZMA 5HRRA 2IYNA 1WETA 4DLEA 4FJ8A 3DRRA 4WXEA 2P1JA 4DSJA 2HHVA 3KLIA 2R7YA 2MSWA 2I5JA 3RVJA 3A0RB 4DTSA 3HVTA 3EJWA 1DCFA 1RNHA 3TAPA 5EU7A 4GNRA 3VN5A 2FEKA 3OMXA 4RK4A 2FN9A 1U49A 3L2RA 5HROA 1VSKA 4FJHA 5FRNA 1RXEA 1DBPA 4IFYA 3RVPA 3NAEA 3OYLA 1L5ZA 2PZSA 4DS4A 1BDIA 2F8TA 4RG8A 4N0QA 3C97A 2P4UA 4FLXA 1ABEA 1U48A 3ALYA 3K5MA 5JNTA 4YWHA 1LBHA 5BQ3A 2QSJA 5IUKC 1D1QA 3ASMA 4F4KA 2E6LA 2IDMA 1HYZA 1KRPA 4L8RB 2L2QA 3F6PA 3MXMA 2D0AA 3HSYA 3TARA 2BE2A 4ICLA 4B3OA 4NHAA 2B4JA 2RJNA 1BISA 2G8IA 5KRTA 2HQRA 4FJJA 1SRRA 2PLNA 3DRSA 3GWGA 1QE1A 4DFMA 3PV8A 3AO1A 1HYSA 1CXQA 4E7IA 4DQPA 3F9KA 2XY5A 3CNBA 2PYLA 2OZSA 3F7NA 1YK1A 1USKA 3O1IC 3OJUA 4E7LA 3FMVA 4L4UA 1T2RA 1HNVA 4TLMB 5IX8A 5T3YA 1NXTA 3S99A 5TPWB 4RK1A 2FVYA 1KVBA 1ASWA 3QLHA 3EQZA 3V9WA 5HLFA 3DLEA 1GOCA 3KK3A 3SUNA 1JWLA 1M2EA 1T8EA 4MPTA 3MJ0A 1C0MA 3ZSZA 4RKQA 4IG3A 1S9GA 2KZZA 4KK4A 4MQEB 4QYWA 5IEJA 1LV5A 4IBNA 3HJFA 3DRPA 3OYHA 1EFAA 3C6QA 5D2CA 4UHJA 3OYIA 5TE9A 1KRWA 3C3KA 3CFOA 4NYFA 2OYQA 5FWYB 1Z2DA 4KO0A 4NGCA 4CERA 1IKXA 5HM6A 3H1GA 3L6UA 3B2NA 3QIPA 3ROTA 2GWRA 1ZH2A 3JPYA 4HVJA 4FJLA 1W25A 2LUOA 2OPQA 3WNFA 4OKKA 3O74A 3CG4A 2WMYA 3CM5A 4G0MA 4HCBA 3VQ8A 5DK5A 4CF2A 4KRFA 5FWXB 4B08A 3IS9A 1NXWA 4JA2A 4G0OA 1SL1A 1DBWA 4M3RA 1CZ9A 4CGFA 3MEDA 4E7OA 1OXBB 3NF9A 3PO5A 2RDMA 1K68A 4CFDA 5HQJA 4LY7A 3BILA 4G0QA 1SUQA 4HTUA 3TI0A 3C6TA 4YCSA 2E4UA 4M88A 1KSPA 2XY7A 2R47A 4C8MA 3KLGA 1S1TA 2Y1JA 3QLVC 4FCYA 4RK0A 2WRZA 3VNAA 3OLWA 4FW1A 3PO4A 3MQ4A 3HDVA 3OO1A 3GBPA 3AO3A 1PEAA 2WB4A 1RT3A 2IAJA 4E1NA 4O0IA 4N5SA 4FJIA 3L3VA 3O2SB 4DLGA 3PY8A 5CNMA 4BDPA 3ZSQA 3RVRA 3W9SA 4F3TA 2QV0A 4LX8A 2GI4A 4IF4A 3I09A 1E6LA 4DF8A 4N76A 4NGGA 2HHQA 2YNHA 2HNZA 4RW7A 5DCLA 1IG9A 4J2AA 1HEYA 4OGEA 3KJXA 4K8ZA 2WONA 4MRMA 5I42A 4BE2A 2DRIA 1TMYA 4XAQA 3UUGA 2BGGA 1FKPA 4FM1A 4PEVA 5KQMA 1Z25A 5EWJB 2HJ9A 4CGJA 3CG0A 2XDYA 1W9HA 1S1UA 1RT4A 4O4GA 4Y1CA 2IPAB 2B6AA 3HZHA 1SD5A 1L3VA 3T19A 4RS3A 5F64A 1W0HA 1EP4A 2VUHB 2Z1HA 4CJWA 1GUDA 4M3ZA 1X1PA 1NATA 4E7KA 2VUIB 1J53A 4B9MA 4LSLA 3SAJA 1QP7A 3KSMA 2DFHA 3KTOA 5HBMA 1NKBA 2PUCA 4NGFA 4M3WA 3ZT2A 3T38A 1DG9A 4O1IA 5T7BA 1S1XA 4DSFA 4IRXA 3DOKA 3AA4A 3C95A 5IEBA 3DLKA 1BIUA 3DBIA 4BDZA 4OATA 1ASVA 3ZSRA 4RK5A 4CJEA 9ABPA 3B6PA 3B6OA 3PX0A 1NXSA 1USGA 1D5WA 3MM4A 4KHUA 3WNGA 3MEEA 3KHTA 3TANA 2NUBA 1F21A 3NF7A 3H5VA 4HUFA 1NJXA 3JVDA 6ABPA 2ETJA 1K66A 1QTMA 4FM0A 3LPTA 3AVKA 3N0WA 3CU5A 1Z15A 4EZ9A 3LZJA 1ASUA 3HV2A 4OTZA 3LP0A 1JXEA 2XFMA 3LANA 3R0JA 4N56A 3I0RA 3LPUA 4CEQA 3O3GA 1NK6A 1VKRA 2MYPA 3L2VA 2IOYA 2YKNA 4O44A 2FQXA 3C6UA 3ZT1A 1T05A 4UQGA 4CK2A 4LH4A 1FFGA 1RTHA 4YP9A 3N0RA 3DZDA 1I3CA 3NNDA 4KHWA 4F2SA 3LFTA 3AVFA 3LWLA 4DTPA 4MYRA 3C3MA 4HNSA 1JL1A 3LAKA 1JDPA 4JB2A 1F51E 3H1EA 2FBYA 1JKHA 1YTAA 3DM2A 3OYMA 3JYTA 4NCBA 3QEWA 3L8BA 2RGYA 2GUIA 5C42A 2LPMA 3FFXA 4FZYA 3NF6A 3OYCA 2WWVD 3LKBA 5CYMA 1WSEA 4CGGA 1DP4A 2F96A 3MYYA 4O1HA 2NZVG 3O3FA 2EX3A 4RSMA 2HQOA 3D0PA 4CJ5A 4C8LA 3HO1A 4PQUA 3JPWA 4B9NA 2FBTA 4LRQA 4O55A 1GLGA 1VSFA 4DSEA 4BE1A 1VYNA 3QINA 5J2NA 2PMCA 4IILA 4G0ZA 3OQNA 4B8CA 5JS2A 2E4XA 3L49A 1KVCA 2HHWA 4XASA 5CYQA 3QEMA 3EULA 4JASB 3AA5X 1WN7A 3F73A 5JNWA 3RVKA 3RVMA 3CG7A 4RZSA 4KQ9A 3LUDA 1RDBA 1AB6A 4OPKA 4E7HA 4QCLA 4Q7EA 4B9LA 5C5CA 3H75A 2O4IA 1WSFA 5KQGA 3O1JC 3CLKA 4WZZA 5DKFA 4GVMA 1P2FA 2Z1GA 4H4OA 4FJKA 1RPJA 4MQFB 5HSGA 3SI6A 1USIA 3QEPA 1DRKA 4CEAA 3HM9A 2AYZA 4HCCA 3TMYA 3M6MD 1TKTA 4CK3A 4FJNA 4HNQA 1Q9XA 1XWLA 1R0AA 4Z4EA 4FE7A 3VQDA 5SZTA 2PAFA 3AV9A 3RMBA 1ZBIA 4JS4A 3BGRA 3RMCA 4QICA 3C3WA 3QESA 4CFBA 2B4AA 3NCIA 2X78A 2L18A 2MYTA 1C6VA 3LDSA 1ZGGA 4F11A 5PNTA 2KW4A 3I8DA 2HSGA 1HQUA 2ID7A 4CESA 3S9HA 1VSJA 4FB4A 2R4QA 4G97A 3H5WA 5KQPA 3OM1A 4DTUA 1QNLA 1RBTA 3FFIA 4FJ9A 3AVIA 1UOCA 4MGEA 3TD9A 1C1BA 3OO0A 2FQWA 4Z4IA 1NK9A 2E4WA 1ZESA 1QS4A 1JL2A 3QX9A 1N6QA 1JLAA 1QHTA 1CLQA 4FLZA 1NJWA 4EYOA 4S04A 4JS5A 4OG2A 3LZIA 4KVFA 1GUBA 1EKEA 1JLKA 4CHQA 3AO4A 4RW9A 5FBHA 4RW8A 1PNRA 3T95A 5J1EA 1UDRA 2NZUG 4ZYLA 3SV3A 1XHEA 3SJJA 4KHYA 1LJUA 3MAQA 1P8AA 4RU1A 3NHGA 1E6KA 3SQ4A 1XHFA 3HYFA 3HK2A 5JNSA 3IPAA 3RVQA 3P1GA 4WT7A 3HT3A 4DTXA 3OMWA 3T8YA 1BCMA 4H3KB 1RT6A 3HUUA 5CZ1A 3BBLA 5CHYA 1GOBA 2I6FA 2OENG 3Q7TA 3U3GA 1TLFA 2MSKA 3VA3A 3OYNA 3OYGA 3UK0A 1D2AA 1URPA 3AVMA 3UKJA 3U3YA 1SKWA 1ITGA 2IS3A 3N6VA 4NGBA 2HVIA 3NF8A 1A0OA 3N8IA 4DQSA 3CFRA 4YGXB 2DTUA 2A9RA 1KFSA 2HHUA 4DTRA 5TPWA 3VQEA 3FFWA 1CEYA 4NQRA 1NK5A 3ISNC 2X6NA 2FXIA 5ABPA 3AVJA 4P98A 1KLNA 1RTJA 3MEGA 2XHBA 1YMVA 4IKFA 5TQ2B 1WSJA 4M45A 2KFNA 1ZYQA 2Z1JA 4CFAA 1NK8A 3KLOA 4GW6A 4PE5B 3JSMA 4KK3A 5DMRA 3VQ4A 4EZ6A 4OGCA 1NY5A 4DTNA 4KFCA 1MIHA 5E3JA 1SV5A 4AHUA 2GX6A 3HCWA 1A04A 1SXIA 3Q7SA 4KI6A 2G8VA 2GBZA 2HPHA 2IPNA 1C4WA 3H6GA 3V9UA 3AVNA 4DU1A 2ZD1A 3VNBA 3SQ1A 3QEKA 1ZH4A 2G8KA 1QQAA 4KREA 4HUGA 5IULC 1DC8A 4EVQA 1ZHHA 3K5NA 3AVHA 1ZBHA 3KK2A 3TO5A 4HNRA 4MQFA 4FE4A 3Q7RA 3LMKA 2H3HA 1IKVA 2WJAA 1D9FA 3OS1A 2GV9A 2CD7A 4JAVC 1GCAA 4R5PA 4J2BA 1DTQA 3IRXA 1RZRD 2BDPA 1F4VA 3SUQA 4ZMRA 1LWFA 3VQ6A 4Y1DA 2YHAA 2D0BA 5TQ0B 5FWXA 1NKCA 4DFKA 1ZDMA 3RR8A 2YNIA 4M42A 2HNYA 3AA3A 2QVWA 1A5XA 3OS0A 2LP4Y 4LE2A 4I2QA 1C0EA 2FMFA 3RVNA 3DLRA 1S1VA 3K9CA 4EYQA 4FLUA 2JVIA 1ZBUA 4CK1A 3DLGA 4DU3A 4ELTA 4FW2A 3UIQA 1JH9A 3K2PA 5IUNC 3M9XA 5IUJC 3KCNA 4D6YA 3V1RA 4LE1A 4PICA 3OLYA 3CHYA 2ZQBA 4DTMA 3MA0A 3F6CA 2ATQA 5FDLA 1JL3A 1BCOA 1LK0A 4MLCA 4TLLB 4NV3A 1GOAA 4S05A 2QZJA 1BA2A 4FK4A 3LTEA 4W5TA 1RZRA 2IPMA 3NGIA 3KLEA 3KTQA 5FROA 4MRMB 4G0YA 1Z12A 4CJ3A 4XXHA 1IH7A 2FLKA 1KRXA 3GL9A 4FJXA 1DRJA 3CKMA 1J9AA 2VWJA 4RXTA 1EX4A 3IP5A 3MXJA 3SQ2A 2WJWA 2GKGA 3TAQA 4QOZB 3CFPA 3SCXA 1MAVA 3AA2A 2VG5A 3NE6A 3O7XA 4DF4A 3QNNA 3OYBA 3TWHA 1TKDA 4CGHA 3S3NA 1TL3A 2Z1IA 4AHSA 4AILC 3BRSA 5IBQA 4KHSA 1EAYA 1JBEA 3QLTA 3M8PA 4FK2A 3LOPA 1TK5A 4P1ZA 1Z26A 1JLQA 2CWDA 2ZWMA 3M8QA 1U04A 1D4ZA 4DADA 3V9XA 1FKOA 3TAMA 1D8YA 1NK7A 2MYUA 1ZGZA 4H60A 3HDGA 4Q0BA 1ZBLA 4LE0A 3KD1E 3WNHA 4M3TA 2WOMA 1KVAA 3C94A 3KKEA 1B00A 3SUOA 3P9YA 3G10A 3QETA 3PUFA 3QLVA 4XIUA 1YTUA 1T34A 2RJOA 4ZHRA 4ZMSA 3LUKA 4Z4GA 4DWIA 2L5CA 3IP7A 4W5RA 4IG0A 4B9VA 3G1WA 4PUOA 1BVHA 2OPPA 1SKRA 2QKBA 3FGZA 4CHOA 2PL9A 4HUEA 1U8TA 2JVKA 1ZVVA 2IKSA 1VLZA 2NT3A 5HRSA 1HMVA 4ID5A 5KI6A 3AVGA 4IGAA 2YNGA 1NKEA 3T6KA 1TGOA 3EZ5A 3HXMA 1R8JA 2N9UA 1EXQA 2RN2A 5TQ0A 2QU7A 4ETNA 4FLVA 1KMIY 4ZPJA 3BRQA 2PUGA 4N41A 4H4MA 1NXVA 5JNRA 3RWUA 1YS6A 3KD5E 1TAQA 1G15A 4ZJPA 1BDHA 3NH0A 3O75A 1T2SA 3CRNA 1SKSA 4OPJA 4CJPA 3QELB 5KGWA 2LIVA 3KS9A 4CGDA 1BQNA 1B92A 8ABPA 2VWKA 4AHRA 2A1SA 4B9SA 4DQQA 1ZBFA 3LAMA 3A0UA 3TABA 1LAVA 3MF4A 1JFTA 2L5DA 4YLEA 2A1RA 4BE0A 3IPCA 5CNJA 2FMIA 3V9SA 4OKJA 1XI1A 3EY1A 3KYJB 4CCHA 3CZCA 4EYKA 3SQNA 3CQ8A 4JB0A 4CJLA 3RRGA 4PY5A 1MVOA 2PUAA 1U4BA 3NNNA 4M3XA 1JXBA 1UA1A 1TAUA 4I7FA 3ZCMA 1TK0A 4E3SA 5KC9A 4MQEA 1UWBA 1KTQA 4AHCA 1A5VA 1JFSA 1D9DA 4CBVA 3ZT0A 3A10A 2G8FA 5B3JC 2QXFA 1JX6A 4RY0A 4DG1A 2RKIA 3V1OA 1L3UA 1NXPA 4O5AA 3QEIA 4DFJA 3IG1A 3JS5A 4MLDA 3GV0A 5D3GA 3EQ2A 4JRQA 2Q3SA 3N75A 1VK0A 3Q9SA 4EP5A 5B3JA 5BR1A 4NH3A 4CECA 3V6DA 3I45A 4DFPA 3IP9A 2QR3A 3LWMA 1P6UA 2PUBA 4KNYA 3HUTA 3G0ZA 2VG6A 4FYDA 3OLXA 3OVNA 3OYKA 1BI4B 3RVOA 2PJUA 4YS6A 3VQ7A 1YS7A 3MMNA 4F8RA 4PA1A 5FBKA 4CEOA 1S1WA 4CF1A 3QX8A 5I4CA 1BHLA 4CFCA 5CNIA 3SV4A 3VQAA 2P5OA 1M2FA 3H5IA 1RT1A 4CEZA 1UAXA 1Z17A 2FW0A 1UA0A 1NOYA 1L3TA 1BI4A 2YNFA 5C24A 1J5OA 1E6MA 2IOCA 4OKEA 1EWTA 4AH9A 4Z4CA 3SNKA 2W42A 3IDOA 4RXUA 3NFAA 3AVAA 4HHTA 2R48A 4N47A 2P5GA 3RRHA 3AVCA 4Z99A 5CZ2A 1WAJA 4DMNA 4Q6WA 3OQOA 4J2DA 3FDFA 1LBIA 3NHZA 4CF9A 4TN5A 4KQCA 2VYCA 3GRCA 3OLVA 3PX4A 4YO7A 5EWMB 1QSSA 4MS4A 2X74A 4JRPA 1TL1A 1VSMA 4G1QA 1IIBA 3JTEA 3QNOA 4EYGA 1LJLA 3NH2A 1D5AA 4M3YA 5EWLB 3LP3A 4KB0A 3ROFA 1WAFA 1FFWA 3O2JA 5GOTA 4OBBA 3NGYA 2AYXA 3K5OA 3T1AA 3NNSA 2IDOA 3GYBA 3Q15C 3SYZA 1RDDA 4XARA 4JP1A 3SPZA 1EHCA 4FLTA 5J2MA 3P5JA 4QAGA 1JLFA 5DGCA 2R25B 4D6XA 3JY6A 2FMKA 2OPRA 1X9WA 1YMUA 2BANA 1RDCA 1T03A 1RNLA 3EAFA 4FXDA 4E7PA 1ZITA 4O0JA 1Z2EA 3MIZA 1QMPA 4LDAA 3QIRA 4G0XA 3L2QA 4QPJC 3OYJA 4LD0A 1QKKA 1NK0A 5J2QA 1DJMA 2O4GA 3ZSVA 3CYMA 1AB5A 1JFVA 1MB3A 4ETIA 1JYEA 3VQCA 4DTOA 1U2QA 4FJ7A 4Z9AA 1J56A 2KZMA 3K57A 5TQ2A 3I42A 2M98A 1XHXA 3VQQA 4NGDA 3H5TA 1VRUA 1EETA 5IC5A 3QEMB 4DSKA 1NK4A 4MS1B 4KI4A 4CE9A 4DTJA 5K14A 2PL1A 1ZY2A 1RBVA 7ABPA 1ZN2A 2KYRA 1SL0A 4ELVA 1JLBA 1NJYA 4KAZA 4WWHA 4FLYA 3KYIB 4HYEA 3QLUC 3NDKA 3OYDA 3SUPA 3LP1A 3HS3A 5EWMA 2HB5A 4RY9A 4QYMA 1VPWA 1C0UA 1JF8A 4IFVA 3LUAA 1IKYA 1JHZA 1M5UA 2P9HA 2ZAYA 1L3SA 1HNIA 1YK0A 2PUDA 4MAAA 4IDKA 5KTQA 4Z4FA 3OM0A 1ZAYA 1Z13A 2D5RA 2B5JA 4RDCA 4CIFA 4EUKA 3RMDA 4J2EA 3TAEA 3EDCA 4OLAA 1M5TA 3HPGA 1DCKA 1DBQA 4I2PA 1XWWA 3LUGA 2O20A 1FSPA 3KKRA 3RTVA 1J54A 3LUCA 4B09A 4Y9TA 3IP6A 3OYFA 2PKXA 4CEDA 4DQRA 4NICA 3GBVA 1REVA 3V1QA 4EP4A 3ZSYA 3G85A 4OVLA 4M3UA 3Q41A 4KB1A 1PUXA 3EGCA 1CXUA 4GPAA 4I9LA 2FFLA 4FZXC 3H1FA 3ITHA 3V81A 4RKRA 4IMJB 3OS2A 3HL8A 4E89A 4ZTFA 3A3KA 1S5JA 4Q5VA 4ZTJA 4AHVA 2FTKE 2QVCA 2Y1IA 2G8WA 4KTWA 3OQMA 5GQSA 4M41A 3LUJA 5DTEA 2HNDA 3RVLA 3CS3A 4CJVA 2JVJA 3WNEA 2MYNA 4D74A 1JDNA 1H9CA 4UHKA 2HHTA 2JRLA 5BRAA 3AO2A 4CHNA 3DMJA 5C5EA 1GCGA 4E19A 4CJRA 3QLUA 4XFKA 1EWVA 2FBVA 4O5BA 1U45A 1JYFA 4Z0UA 5KQLA 4NYNA 2PY5A 1HPZA 4TSXA 3P83D 4YV7A 1Z16A 4MS3A 1KFDA 4GMJB 5KGXA 3M8RA 1QPZA 3V9ZA 4EGSA 3OYAA 3QK7A 3QEXA 3OY9A 1WSHA 1RXIA 1CZBA 1MU2A 1DLOA 4BDYA 2CHEA 1DZ3A 2J48A 1KCFA 2E4VA 4C8OA 1QO0D 1RBUA 4CJ4A 1YIOA 1TKZA 3L2WA 1HJRA 2FC0A 2LSNA 3DYAA 4I9QA 3O3IX 3RH0A 1RBRA 4JOQA 2TMYA 4MQ3A 2OPSA 2FQYA 1VSIA 4ML3A 4MR9A 1DTTA 1C1CA 1QP4A 3PX6A 4W5OA 1VSLA 4RV5A 2Q5CA 4MR7A 2LBPA 4CGIA 5TPZD 2HHSA 4ID1A 1APBA 1SI3A 2VK2A 1TV6A 1SXHA 4NH6A 2AJQA 1B9DA 4CEFA 1Q8IA 3SQ0A 3SG0A 1K6YA 1C0TA 4FJ5A 5HRNA 3DLHA 2QXYA 1B9FA 3TAGA 2FMHA 2KTQA 3TB6A 1NTRA 2YKMA 4RY8A 4MR8B 4BWMA 3BREA 4LSNA 5E41A 4E0DA 1HYVA 1D1PA 4FJGA 1R4KA 1JLCA 4CIEA 2G8UA 1LW0A 2E4LA 4DSLA 3K59A 2PYJA 4CJSA 1VSHA 5FWYA 5TPZA 4KKOA 4MS1A 3ZT3A 4N0PA 4KMRA 3KLNA 4F2RA 3QERA 3THVA 3ZSWA 4RWEA 1RILA 1TM2A 4Q6BA 4Z4HA 3KKSA 1QSYA 2OA8A 3OJSA 3K58A 4NCAA 2E6MA 2RF2A 1NJZA 4RK7A 4RW4A 2JGUA 4MFBA 4MS4B 1SI2A 2FLWA 1HRHA 1KLMA 4BWJA 1KGSA 1Y1LA 4C8NA 2IC3A 5ED4A 2XO7A 1U47A 1RT5A 5C25A 1R6ZA 1DC7A 1TVRA 1MB0A 3O21A 3ULDA 2MSLA 3NH1A 2IGIA 3V4IA 4KPYA 3EYZA 4DQIA 2A9QA 5FRMA 5HKOA 4DU4A 1FQWA 3VQBA 4BACA 1VSDA 1E2BA 1FFSA 3SY8A 4MS3B 3RQIA 1LAWA 4YNQA 2A9PA 4B8AB 1PEYA 2JBAB 2PUFA 2HVHA 3HPOA 3VA0A 4CF8A 3KJVA 3EODA 3O3HA 2JB9A 4PYRA 2HW3A 4K8XA 3GA5A 1LW2A 4FVMA 3VQ5A 3ZSOA 3RVSA 3MXIA 2JCGA 2GBPA 3K4HA 3LKVA 4YR7A 1C1AA 3O7VX 4Z0NA 1QP0A 3M8SA 4F12A 5JNUA 4FK0A 1WLJA 4AHTA 1N5YA 3O1HB 2DFEA 1XC9A 4F06A 3U6FA 4JLHA 1I39A 1VRVA 4NH5A 2KFZA 2DFFA 5TQJA 4PZ0A 2HHXA 3QO9A 4G86A 1XHZA 4OLBA 1BL3A 3K5LA 5KRSA 4MR8A 3LP2A 4W5NA 3E01A 1RTIA 2OQRA 4RXMA 2FN8A 2IPLA 3NBPA 4EY3A 3KLFA 3KK1A 3D45A 1O1WA 2VG7A 3AVBA 4E1MA 2L19A 1Q9YA 1NOZA 1QQCA 4CJFA 2X6SA 3KIOA 1S9EA 1TKXA 5I3UA 4WUTA 4MR7B 4TMYA 1L5YA 5SWMA 2XY6A 4FJMA 1BDJA 2EHGA 4W5QA 4KFBA 1SXGA 2JK1A 2FKAA 5HP1A 1X9SA 1QO0A 4G0PA 3CTPA 3OLZA 1CYEA 3H08A 4B9UA 1QQBA 6CHYA 2ZE2A 1VSEA 3HSTB 5BRJA 5JNVA 4L85A 2FBXA 1IO2A 3VQPA 4CIGA 1CHNA 3SNNA 4KHQA 2NT4A 4XLTA 2WY2D 5EWLA
chains in the Genus database with same CATH superfamily
1Z05A 2NV0A 3MJDA 2FUG1 3H9QA 4OA5A 1P6QA 1U2PA 4B1ZA 4C0SA 3VEZA 1ETHA 4ABTA 1OAOA 2P75A 2WV9A 1X0XA 4H1WA 5JY6A 1HQKA 4NONA 3O4QA 2B5OA 1V16A 1AQUA 5AZIB 2GOYA 4N6NA 2BCGY 1H0HA 1RWXA 1UJCA 1Z35A 3LUHA 2VP9A 3PX3A 4N49A 5ESDA 2IWRA 4JV5K 5A5VA 2Y0PA 1SL2A 1PW7A 6REQA 3TIIA 3AW8A 1N5RA 5HCIA 4NHEA 3GGSA 4JBWA 3CC7N 4LDJA 4LWZA 3OEEA 4D6PA 5BSUA 5A1TA 3O8DA 5IABA 4OJRA 2VQFK 1U7UA 2IVZA 3AI2A 3NVAA 1P7VA 2CXHA 3I0NA 4WE3A 4BROA 1XD2B 1K8YB 2P6OA 2QA5A 2YY5A 4WNIA 3RRZA 3UV7A 1S6QA 5KWSA 4RFLA 4HQ0A 2BMEA 3PUIA 2G06A 1IIRA 1PGOA 3KKZA 3U17A 1UPUA 3M83A 2LXNA 1IHDA 1QFZA 2Z08A 4G9ZA 3F5TA 2HWYA 3FTQA 1O9BA 4FDTA 5K3EA 3B85A 3ZVKA 4KHNA 2QWOA 4BO1A 1WUYA 5ILOA 5AHKA 2ZZMA 3SPYA 4R31A 1F5SA 2CZGA 4WCVA 1FXWA 4HDRA 3GRAA 3LHDA 4YDSA 3L3UA 3W4IA 3M4YA 1MPTA 1S2NA 1NASA 1X80A 1W0KA 4H7DA 2ACKA 4KE9A 4LRSB 4FWOA 2HB6A 2IPOA 4EGCB 2D59A 1W35A 3NDJA 3AHFA 5JMWA 3K0FA 4KBFA 5K05A 2EL7A 3W79A 3E5RA 2Y1FA 3CZ5A 4NMHA 4L3QA 2J33A 2Q3CA 4URHA 5TEVA 1MW9X 4YUXA 2VGMA 1C7QA 3GD5A 3GVXA 2DY0A 2G1UA 2OKGA 4M7OA 4BIIA 4JY7A 1KOLA 1O94C 1G3RA 1OVMA 2JLZA 3AM4A 1JILA 2AOWA 4H6XA 4IOJA 4FM2A 1GITA 4MW9A 4EW1A 3DOEA 1FK9A 2WTMA 2I7CA 1S8FA 4ND2A 3VHXA 3V1NA 3WLPA 4CKBA 5CXXA 4EY7A 4F3OA 3C7NB 1V2HE 4TUYA 3E8MA 4L4YA 1ZUNB 2WHEA 3SR4A 3IQDB 3KOUA 3UCEA 2A9VA 4KGDA 2BGRA 4BZZA 1Q0TA 3EEYA 3DGEC 3WLEA 4C20A 1QU2A 3RWBA 4Q9KA 2DFVA 4IIJA 3MK6A 1JLSA 4KCGA 4HVLA 5MFPA 4YY3K 1NXQA 1QKJA 1ISIA 4E7JA 5HVNA 3GG2A 1YR2A 2IHVA 3PQCA 4S1TA 1BOFA 4CJUA 2ZUUA 3O6WA 1P5ZB 3O82A 3I37X 3TX6A 4MVJI 1U4SA 4HAYA 1KYQA 2I1LA 2QE7A 2F8SA 2YHIA 3HB9A 2WHQA 4H4EA 3WICA 3PHCA 4S0ZA 4P3YA 4UFOA 2BMWA 5REQB 2EP5A 2O3UA 4MJLA 1A4XA 1R4NB 2RI0A 3DI6A 1TXGA 3NI2A 4TROA 5DGTA 3T12A 1E1CB 4TTPA 1W59A 2EWMA 1EGMB 2FHSA 4K9QA 4PQEA 5J47A 1REQA 2VAMA 2QUIA 4ESEA 5HRUA 2BISA 1GNVA 5D3ZA 5TS3A 4DLRA 2EBWA 2VDRB 2H48A 5LMNB 1BEZA 1NM5C 3A9SA 3RR7A 2UXBB 3RIMA 3ZBUA 4EA6A 3IQXA 4TMZA 3DG9A 2REOA 4Q3NA 1ZR2A 2BFOA 1NNSA 1KKMA 1G8GA 2EP7A 2P27A 5FUYA 1Q2UA 3L2UA 4JEIA 4NCHA 4UHHA 5F4ZA 1BGXT 2WUEA 1I2MA 4YRQA 4CQLB 3HM8A 3IJ5A 2XY8A 2CN1A 1XEFA 3HYNA 4XR9A 3BA1A 4Q18A 4CMBA 3KVVA 4HFRA 4Q02A 9GPBA 4CJTA 1QG0A 5JEEA 4J1QA 2XRIA 2JGFA 2WM3A 2FLVA 3DKKA 3MTAA 5IC6A 2JBAA 3CYFA 4BY9E 2FZ5A 4YXFA 1SA0B 4AYWA 1R6DA 1XXHB 2Q9UA 4FBLA 4KMOA 2NO1A 3O2QB 7ADHA 1FXXA 1NXOA 1WSIA 2RI1A 3TD2A 2Z95A 3AL3A 1ACJA 1Z18A 3L46A 3MCAA 2PUEA 4A4DA 4ELUA 1H42A 3NPAA 2FW8A 2ZR8A 1NJ1A 2HTEA 2VOEA 3NX4A 3FY4A 4R0NA 3U0BA 1Z8DA 3GQVA 4YRZA 1BAPA 3IJRA 5KQRA 2C8JA 4YCAA 2GELA 1CHDA 3H5NA 3L5KA 2FW1A 1YBAA 3O8BA 4P4SB 3KYBA 4ZCSA 5JC8A 1Z34A 5MFZA 1NLMA 4RUKA 1T6XA 2ZRNA 4CTJA 1BYIA 4MR9B 1LWEA 2Y1DA 3LUFA 4DIKA 3FCUB 4IQ8A 3BGIA 2ZQZA 1AURA 1A2OA 1OT3A 1MQAA 4TLDA 5I7OA 2V96A 5AXAA 5K01A 5IWAK 4I1RA 3FR0A 4RKEA 3WLNA 4HX9A 3PIPL 3MECA 5IT5A 1J90A 5IXYA 1HG0A 5CD1A 4FGJA 2X41A 3AJDA 4JT9A 3PSFA 4GR9A 4W7HA 5BOSB 1HURA 2ZJPL 1SBTA 2OE2A 1TVMA 2W2NA 4F8JA 4H0PA 2QGNA 4H0CA 2ID9A 1I3AA 2HRCA 4CZIA 3K71B 5CK4A 3EZXA 3GRYA 2QTCA 3KSRA 3GJQA 5JT1A 3I62A 4GOND 4GPIB 3CFYA 4KSCA 4R1UA 1Q7TA 3CVJA 3K0FB 4NSNA 4RVFA 3UOAB 1QF7A 3M4ZA 3CF5L 5IDWA 3GG4A 3TTCA 3WMWA 4QDZA 3BEXA 4YXWD 1HLDA 1ONSA 1ZNQO 2R8ZA 2PFUA 3GHHA 3LC7O 4JLVA 3ICCA 2BL4A 3VNUA 3C3JA 4O4IA 3F3SA 4TYQA 4XOUA 1I7DA 1K08A 3NJ8A 1CZHA 4LOKA 2UYCA 5I8ZA 1QOQB 3KQMA 4NXNK 3RASA 1HX1A 4LH5A 1S96A 3ZC3A 3SICE 1J0EA 5BSWA 2P1DA 4R05A 2P8SA 1EE2A 3VQ9A 2HCTA 1WWKA 2AI2A 5JIBA 1B2RA 2FAXA 1U8EA 1I7SB 3U60B 1H1TA 2VPWA 2VI5A 3R5XA 2WLSA 2Z5FA 3ETDA 1JA9A 2OK8A 2ZYRA 5K0CA 2OP0A 2RK6A 3AO5A 3HP9A 1K4KA 1G6OA 4X6YA 2OG2A 3QELA 5CRIA 4AD8A 2IYNA 3DXFA 1Q18A 4DLEA 3ISVA 4MEAA 5F21A 5C8VA 2P1JA 3C5VA 4LGYA 1E3WA 3FOEC 1DQZA 1FNSA 3E9QA 1NJIO 4B3TK 4HNGA 1UXOA 1Z6RA 3L06A 4BASA 3HFGA 1JHRA 2R7YA 4EBFA 1KARA 2MSWA 2PL3A 4G4SO 5E8JA 2EWWA 3QG1A 5CA0B 1A4UA 3C6XA 3FRJA 3SF8B 3L8CA 5EC8A 2YN4A 4BLTA 1NZJA 3LM8A 2H08A 5T6MA 3U4QB 1RKBA 4R9SA 4FC7A 3DLIA 4YMWA 1YULA 2XMCA 3R20A 4JJFA 4HWPA 3NKVA 4YJ2F 1TVEA 3ZY3A 3DSRA 3G8CA 4QOJA 1M6YA 2Z2KA 3TMKA 5LJLA 2XCSB 3KOWA 3VN5A 1VSQA 2FEKA 3D4NA 3PF9A 5T41A 1GXSB 2HOQA 4LVCA 1U6ZA 5BRDA 1O96B 1O3YA 1TD9A 3C65A 4ISFA 3L2RA 5HROA 4FJHA 1C4XA 1MN6A 1SCUB 4MO2A 1S2MA 3FZYA 1G5PA 2VRCD 4WFKA 3WFJA 5IPFA 1SGWA 2WIFA 3AWDA 4HAZA 1OB2A 4J94A 1NVDA 1RXEA 4ZZ2A 1K6IA 3RVPA 1AGXA 3MWEA 3RB8A 3NALA 1DNPA 1J97A 3U6KA 4LZPA 1IUNA 1L5ZA 2XRZA 4DS4A 2B82A 5LZ7A 3TQIA 4ZI7F 5J23A 2HU7A 2F8TA 2CYAA 4JI5B 1CY4A 4N0QA 4PLPA 1ZM2A 4W1PA 4WCEL 3QTLA 2NPIA 3HN6A 1FVFA 4LJKA 2JZNA 1OKKD 1CB7A 1BVRA 3K5MA 1C3XA 3ROQA 2IUSA 2O1XA 2P9EA 1LBHA 3DR5A 3N0TA 4YWHA 1ZX1A 2QSJA 5BQ3A 1TVCA 1XZJA 3ZCSA 3ASMA 3OESA 4FOPA 2XXAA 1I13A 1UBJS 3E9DA 2SECE 4X66B 1BE0A 2CBXA 4FZ5A 2BH9A 1DV1A 2P9JA 3E27A 3QPDA 4JD5A 4LJ6A 4PC2A 2Q97A 4X3PA 5EIFA 1JAIA 1NVMB 2X9GA 3QVOA 3ZDDA 3MXMA 3ZCVA 2AVNA 4LHEA 4ES6A 2ZLBA 3TARA 4GKJK 3GDHA 2RHBA 2QEQA 4KUEA 3CJBA 2R7NA 4XEUA 2NRRA 1HNWK 1CFZA 3MJHA 5DU2A 3I39X 2G8IA 4RIHA 4X65B 5H68A 5CYPA 3U9SA 5HR5A 1JHMA 3U49A 1SRRA 5CVCA 3DTYA 3WGIA 3NETA 4KFSA 3A32A 1Z22A 3OE1A 4P35A 5EXEA 1C50A 2PLNA 3G1UA 4A15A 4BR7A 4HATA 4XUCA 1AS3A 1U3FA 1P61B 2PWPA 3WP0A 4A2PA 1QE1A 1Y48E 2ZB3A 3L4JA 4E7IA 3R5HA 4G25A 4O33A 4RZHA 4FXOA 4WOPA 1SKAA 1R88A 1XPUA 4IOCL 4KE8A 5AKXA 4L74A 1GO2A 2C1ZA 3S1AB 1M34A 3PCXA 1NHGA 4IMRA 4I6MB 1UXJA 3PQ7A 1V8FA 2GVNA 1D6SA 3VSAA 3O1IC 4M36A 4LF8B 3OJUA 2ZIWB 4L95C 1P17A 4URYR 1X92A 4LF6K 3G9TA 3L8EA 2QJWA 4Y7DA 4EY8A 4ZI3A 1GZ7A 5J2TA 1LGYA 4B3RK 1U1DA 5T3YA 3GFVA 2E18A 3PPYA 1OIVA 3R0VA 4RY2A 3ESXA 1JZTA 4EQ6B 3KR1A 1NSYA 3V9WA 3O03A 4OQMA 1EGQA 1AXGA 4RLHA 4UULA 4N3CA 2QRMA 4FGWA 3VO8A 1EUYA 3G2JA 1W0KD 1IDN1 2J45A 3KE8A 4JI1B 1JWLA 4MPTA 1ZMOA 3WMRA 5EMNA 5IAEA 2NZ2A 3DNPA 5BXQC 1W7AA 3MTEA 4DNQA 1CS0A 4RH0A 4QYWA 3GLUA 4KYVA 3AL0C 3FCCA 1JG7A 3A05A 4PLHA 1ZUNA 4KIFA 1LV5A 1KYXA 1YIDA 4IBNA 3HJFA 4I6EA 1QRUA 2BN4A 2V3VA 1EFAA 2IUEA 4ISEA 1JDJA 1F4PA 1M1NB 1YDEA 3CFOA 4NYFA 1AH2A 3ZWYA 4ASUD 1EFUA 2R1VB 2ZJ5A 4NGCA 3BHIA 4H1TA 4MUMA 4AULA 1NLVA 4CERA 4CLOA 3A26A 1J1UA 1XMXA 1E4OA 1SVKA 3HTVA 5DTIA 4A59A 2QUZA 3ROTA 2GWRA 3BJZA 1RHQA 4MO9A 2ECFA 4IIJB 2XUGA 3P38A 3AB7A 1BX1A 2PMDA 5EZYB 2WMYA 4IJAA 2ADMA 2XD4A 3UTDA 1MRZA 2AN3A 3N9IA 3UYLA 5F9MA 1BMFA 3VQ8A 2NG1A 3WLIA 5JSZA 4GI5A 5CT8A 4L6IA 4KRFA 2WC1A 1XQVA 1ZQ9A 1BD3A 3QE2A 3PPXA 2WJZB 1YFZA 3A37A 1EDEA 1C1XB 1W5EA 3WVNA 1C4KA 4DT1A 2OCGA 1C7JA 2P7IA 3CRMA 5KPJA 1AGNA 2CVPA 4RKYA 4QEZA 4Q01A 1U28C 4M3RA 4CGFA 3G71N 2QRZA 1VCNA 3FPFA 4IH4A 4M8NE 1OXBB 4RDIA 3CUTA 5FPQA 2DUMA 3QMPA 4MV8A 3GX1A 3TPFA 1AQNA 4DV6B 1XNGA 1HPLA 3ABZA 4J8PA 4PAMA 2HL6A 3GF4A 1P4JA 4GWKA 4RA9B 5HQJA 3U3OA 1XD8A 1KVTA 2J3JA 3BILA 4Q66C 1T5SA 3WB9A 1GGNA 3FTFA 2GZ3A 1XXHA 2IIBA 1NRXA 2ZVPX 3KPUA 2GX9A 1FNMA 1TMKA 1XE3A 1Z0SA 2GMWA 1LDNA 3H1BA 2AGVA 3VA7A 5IAJA 3TLMA 2XY7A 2GFHA 4LV6A 2CDCA 5AKHA 2AE1A 2X1HA 2Y1JA 5TKYA 1SELA 1VE5A 2Q3EA 3QLVC 2ERXA 3DE2X 4MUHA 3ZEAA 5D5PA 1FP7A 4UBMA 2WRZA 5AJWA 3CB2A 1TDJA 1EDZA 4FGSA 4IWVA 3CEHA 1LSUA 4LXYA 5F2OA 4BRNA 1T0IA 3BC1A 4UMEA 5KTKA 5J2UB 2NPFA 1T5DX 2AQHA 1V3UA 1TA0A 3OO1A 1ISGA 2YZGA 3PL5A 1PEAA 1S0UA 1Z47A 3QVKA 3SSAA 1NHWA 2DEUA 1ZD1A 4CODB 2YVLA 3OUUA 3O3NB 5FL7D 2FW6A 3RRNA 4F91B 5KNCH 4FJIA 4LBWA 3L3VA 4JLPA 3TVTA 4I8DA 3NOQA 5HWSA 3U61B 1TD1A 3LKZA 4MRVA 4DPMA 3VF4A 3ID8A 3OUTA 3SQLA 3EXIA 5CNMA 3LNCA 1PYGA 3PGLA 4EUEA 3AO0B 5A5GA 5GM1A 2QV0A 1EVLA 1SRQA 3FFAA 2GI4A 4IF4A 4LX8A 3IEUA 4A0RA 3I09A 2WQ7A 1FSGA 4GM1A 5I47A 3ZEIA 5IAOA 2C2GA 1ID8A 3NHUA 4PRKA 2RHJA 3DZBA 4E2YA 3IOEA 4K86A 4DF8A 1J7KA 1Z7GA 1E2LA 3DD5A 3EWAA 1JI3A 5CEEA 4GGMX 4KAJA 3G0DA 3ZV4A 2H6EA 2W00A 3P9ZA 4BMNA 2HNZA 5FPYA 3ZGYA 3LY8A 1IG9A 3KZXA 4GH5A 1HEYA 3GFTA 4CEIA 1CV2A 2VUUA 3A3OA 4IJNA 1LLQA 1TMYA 3H2BA 4XAQA 1QAQA 5A2QA 4GICA 3UUGA 4CIXA 2H7CA 4ZT6A 1RXYA 1QCYA 1KYIA 2ON6A 4B0OA 3LPNA 1HDIA 2JEOA 4IZ6A 4R7ZA 3W6UA 2QUKA 2YS7A 4GS5A 2IELA 3WB0A 4PCVA 3N4QA 1OHHD 2NSJA 2YMMA 1RWBA 3AFIA 1GD1O 3KOMA 2VZ9A 4TQGA 2GAOA 2WM9B 1DIGA 2Q45A 1JXQA 1SC6A 3UHJA 4CM6A 2CXPA 1M2VB 4EAHD 2IYFA 1DJQA 5FH9A 3I9OA 4Y1CA 1YKSA 2YV2A 4LHWA 4CWAA 4JHXA 2H59A 4LC9B 3J81A 3FOCA 3M49A 2ODBA 1GN8A 1U3WA 5A3SA 4YDUA 3TKAA 1SD5A 1VBKA 2ZRPA 1UJNA 1TJ5A 4KQ6A 4GGPA 5LJIA 2BDTA 3CE9A 1X1RA 4V0SA 4GV6A 4RS3A 2VTBB 5G53C 1Z73A 2HDWA 3PEFA 4BP8A 4KR9A 3GLGB 3DCJA 3M6AA 4UBKA 1NQXA 2R8RA 2VXYA 4B17A 3BORA 3OEWA 5ALDA 4KQXA 2F1RA 1CF2O 1U7ZA 2FQ1A 1N3LA 5HHTA 2Z1HA 4XH1A 1TZKA 4CJWA 3PDIA 1ZNYA 3P9SA 4BJ3A 2XCRB 4PSVA 2B8NA 4NDNE 2HY7A 2YHUA 4E7KA 4DM4A 1YHQN 2BFEA 2XADA 3CWCA 4ZC8A 5CFQA 3NB0A 4G23A 4LMPA 5KOIA 4ZN6A 2W6CX 4R1SA 1GA6A 4EI8A 4HAOA 2G70A 3EFBA 3P0IA 2X8BA 1U0BB 1FP4B 3KTOA 3LU1A 1YVEI 2HRDA 3C8ZA 3MCUA 5HBMA 2ZI4A 1NKBA 2FSHA 3D5TA 4QVGA 5L9AA 2PUCA 1EQUA 1M74A 4AN1A 3U37A 4DYVA 1ADJA 1OV6A 1EKXA 5ISMA 4PLCA 3K6RA 1CUBA 3FZQA 4O1IA 1S1XA 2OXFA 4IRXA 1X0VA 3DOKA 1DI0A 1XTSA 3O8NA 4IH9A 3QXXA 1SXJD 2OAEA 1GIAA 3QUSA 3S40A 3VDXA 4YDQA 2P6RA 2NTYC 4TT3D 3M1YA 5FX2A 1L4FA 2PAAA 3ZSRA 4O4JB 3UXYA 4WY5A 4CJEA 4B75A 3VPAA 3SC2B 4TV8F 1TT5A 3B6OA 2B98A 2XZDA 1NXSA 3CUKA 3EZ9A 3F4KA 4EHAA 1G38A 3TF5A 1L5MA 3VKHA 2J9GA 2C2BA 1QWOA 4KHUA 3ED5A 3ZYCA 4DV5B 4RAQA 4B76A 4H17A 4GPZA 5BR8K 3GL1A 2NUBA 4BN4A 3U56A 3BH7A 4DMRA 4Z0PA 1TGVA 4CKZA 4HUFA 1LV8A 5J2TF 3FMFA 3QPCA 4PKIA 4WN9A 4XJXA 1VMKA 1BDMA 1TUEA 1DAHA 4GBMA 4DNFA 5KO2A 3E66A 1QTMA 4CT5A 4YRMA 3CC2N 1ZR4A 2ZREA 3JZMA 4HQKA 3BSYA 4L9AA 1ZCJA 3HOTA 4QGBA 3R6LA 4MKIA 4D5EA 5LA6F 3S81A 2WDZA 3B20A 2FMXA 1I10A 3D5QA 8ATCA 3QV1A 1TIBA 1IHPA 2M6RA 2W6IA 2DCMA 5DOVA 3ZWWA 2XFMA 4MWZA 2H7VA 1E79A 1BA3A 5FOTA 3X1JA 3I0RA 5DX8A 4CEQA 4C7VA 2X4IA 3E05A 4HAVA 4IOLA 4URVR 3B82A 3DKIA 3FTDA 3EMDA 3GC6A 3TJMA 1N33B 4JYMA 1UPBA 1H8EA 3AT1A 3HO8A 1ZXXA 5GAGP 2YKNA 1AD2A 2XZTA 4GEGA 2QTNA 2NMVA 2DE0X 1YJBA 4P0PB 1Y64A 2OFOA 3J80A 5EJ6A 3ZVRA 2POCA 4LJLA 3INTA 1VCIA 2ZQ5A 1ZK4A 1LPAB 5KSPA 5K6RA 3DCNA 2DPXA 2WPDA 4JLAA 4XIIA 4JUFA 4LH4A 1D0SA 3I1IA 1K8KB 2WWWA 1Z6QA 4JI3B 3DYVA 4AZVA 3RIGA 1FNBA 1K97A 4R6WA 1GP2A 4DMUB 1UZUA 3UJNA 1J49A 3BIFA 2RGRA 2VP4A 3GPLA 4OF4A 2IU3A 3C8HA 3AVFA 2VYNA 3NEYA 4LAFA 4BXOB 3A9VA 3NG1A 1LZKA 1O57A 3W2HA 1VMAA 1GWNA 4X1OA 1JL1A 3B53X 1XL1A 4BFCA 3GLKA 5KIAA 1P91A 2H9AA 2WYIA 3CVXA 3H1EA 3FNRA 2WJYA 2GT1A 1MDBA 2FBYA 1DTEA 1BW9B 1YI0A 1XRNA 1HDCA 4Q7MB 4W8GA 3KUXA 2VGNA 1E0JA 3OYMA 1GR0A 1QHHB 2I78A 4NCBA 4R7GA 2JLUA 2BFMA 3X1KA 1MKYA 3D2AA 1PL7A 1DRUA 4JQSA 1XQ6A 5E2IA 1GYPA 2HKIA 3ZHYA 4ILEA 4FHGA 4BN0A 4M99A 3U4HA 1P72A 4B3CA 4PX9A 3KTAA 1CIJA 1KI6A 3NGMA 2GTIA 1UANA 1HUQA 4FVUA 1YB2A 3EC1A 4MYCA 5K0FA 1A7JA 3LKBA 4J0KA 2AXPA 3OZ7A 3ADBA 4MO5A 2DYKA 4IOMA 3REQA 1TCUA 1WSEA 3MGGA 2R86A 1OAKA 1X13A 3GNLA 4Q7JB 1CBUA 1V4TA 1UBHS 4BV3A 3K5HA 2Q99A 3IRUA 5KNLA 2AMVA 2H5LA 4RSMA 5HZMA 1QJ4A 3N8HA 4LHZA 1NV9A 2PSSA 3BSWA 4OK6A 3JRXA 1NGSA 1YH3A 4P80A 3NWOA 4R54A 3ZXSA 1GPBA 3QXHA 3VH3A 5B6JA 1S3IA 1DOHA 1SN7A 2P9FA 4PQUA 3FNHA 3KKKA 4X8OA 1VQ7N 2BWJA 1N1GA 1QONA 2R6FA 5JG7A 2FBTA 3LPCA 1A82A 5F5LA 2CE7A 1PAUA 2OAQ1 4BO7A 5JH7F 5DLPA 4CM9A 1GLGA 4I5IA 2GRAA 3A06A 4MVJH 1P62B 3L7CA 4O4HF 4COKA 5AVRA 3DEFA 5JSUA 1EJ6A 1PR6A 2H4FA 4IILA 2C78A 1TUBB 2QJRA 3QX7A 2XDQA 4G0ZA 3CO0S 1NM1A 1OZHA 4KR3A 4FWSA 4B8CA 1YR9A 7MHTA 3DZKA 1UFKA 3L49A 4NJMB 2HHWA 1I51A 3L2OB 2EV9A 2QF7A 3UAXA 5T4EA 1G7SA 2OO7A 1ZIPA 2PO5A 2WVAA 4XASA 1LS1A 1JJFA 3MD9A 1XELA 4C0WA 2VXOA 2HBJA 4R2XA 5I7SA 2Z2JA 3QEMA 5BT9A 2BV3A 5LYJF 4DVJA 3TXYA 4OD0A 2B1QA 4CHTA 4I4TB 1WN7A 4X7PA 1T5IA 5J3JA 2AS0A 3DYIA 4CV2A 1GAJA 1CTQA 1SQFA 3UPDA 5L3SA 4MICA 3CKYA 4BVEA 4OP1A 4R3WA 1C3VA 1EB9A 1HDXA 4PCLA 4RZSA 4M1WA 4EW6A 3WLQA 3ZK9A 1ZJZA 3D8RA 4GYJA 2D1TA 4YJFA 4HMOA 1WA5A 2Y66A 4Q7EA 4QCLA 3M7IA 1JR3A 3H75A 1WU8A 4BRFA 4QQNA 5KQGA 3T5MA 2DQ4A 5IG2A 2G77B 3O1JC 1JAXA 3HTXA 4IDPA 2OV2A 4OI2A 1FFHA 1PDOA 2C0CA 3A0IX 2Z1GA 2C9MA 3ANLA 3F7MA 4H35A 5EEHA 1WE2A 1Y42X 1RPJA 2CNWA 1P5RA 3R3VA 4OXYA 3D1VA 4IVNA 2D0OA 1XYGA 3TFQA 2OTJN 1USIA 5AJVB 1G5FA 3QBTA 3V46A 2FP3A 3QEPA 1DRKA 5JW6A 4CEAA 3HM9A 4O63O 4V0NA 3HCCA 1OWOA 4GUAA 4CV1A 1A1VA 2P9PB 2FVXA 4BG9A 2UKDA 1YKGA 5IANA 2ZVJA 5DGDA 3DEIA 4BLRA 3NATA 4WK4B 1KMQA 1RU3A 2FSVC 4FJNA 3MUFA 1M2OA 4X8LA 3MBKA 4HNQA 2Q2NA 5AQJA 1Q9XA 2FN3A 2O19A 3KOZA 3CZMA 2GDZA 1E64A 2GYVA 3VEYA 2QM7A 1NJ6A 2X4DA 3VQDA 2YV1A 3Q8WA 4QE3A 1CEEA 2PAFA 3K09A 3ZZTA 3B3GA 1PJSA 3AV9A 3ZOZA 3KK7A 4JS4A 3JAKB 5KNCD 1KSJA 3BGRA 4EHUA 4BRIA 1JHXA 1YHYA 3CCRN 2JHAA 1VAZA 5THXA 3WMGA 4YDUC 3TH5A 4L1PA 4LWQA 3JZDA 1KR5A 3U0VA 5JYDA 2P2DA 4M76B 1B74A 3AF3A 5KVQA 4V1CA 4PWZA 5FUXA 3ZDFA 5MN4A 1TYDE 1PGJA 3IBCA 3O9UA 1CWUA 4QELA 2F1OA 2H2IA 2H2WA 4M3NA 4NS1A 4UKDA 3CGWA 2MTBA 3NCIA 2AG5A 3FGOA 1GM5A 3JQAA 5J9FA 1T3GA 3RIHA 3VYUB 5KNBH 3LDSA 3CLSC 1Z08A 4OI1A 4JOBA 1H3NA 3H97A 2D2IA 3JVUA 3NT4A 5CLIA 3I8DA 2DTDA 4QTYA 3PJRA 4G0UA 4CESA 2VRWA 1SVUA 3JYLA 3FUCA 1YJWN 3KL4A 2AOUB 5HF6A 3ZETB 2PH7A 3C0KA 1G98A 1RWNA 2QXTA 2VJMA 4CMCA 4B3RB 3OM1A 2E5LK 2IEBA 3SAFA 3NYQA 3P45A 1ZN8A 2HJHA 3NRCA 2JLQA 4RAOA 4WERA 3RC3A 2ST1A 1QNLA 1RBTA 2JGAA 4CLRA 3X3HA 3CPEA 3VO2A 1L4BA 2CUZA 2MMCA 3GRKA 4JB8A 4JDUA 4FJ9A 1LLFA 4QA9A 3GGCA 5AT1A 2C4TA 3RT9A 3UGQA 3C6AA 4F3NA 4DB3A 1E3QA 4J4TA 2DFDA 3F9CA 4HSGA 5CAEB 4DL9A 3OO0A 2XRYA 1BWFO 2AWNA 2FI1A 2RIPA 5F1OA 3SIXA 4AL4A 5JJBA 1ZESA 4D26A 4PLYA 1JL2A 3NAQA 2PTGA 4CG3A 1Z4NA 1YRHA 3ZZNA 4OJYA 1S4MA 1O4WA 1ZIOA 4FLZA 3F3YA 2BTQA 1B6GA 2ENWA 2QN8A 4G4GA 3UK1A 1M8JA 5EZYA 4EYOA 5AW3A 2VPPA 3INRA 4ZAZA 1EFCA 1JEQA 2I4OA 3LZIA 2NTEA 4JBNA 4BOYA 4IEIA 1GUBA 4PWYA 2QAIA 1XLWA 5JYCA 1DWUA 1EFDN 2ANCA 4HQFA 4MB2A 2HA7A 3TW6A 2QM1A 3WGLA 4F9EA 3VTZA 1RRVA 5BN5A 3FKSD 3T4XA 2FE1A 1TT7A 4QPZA 5FBHA 1KQOA 2A0UA 5A1JA 3CQYA 2PNJA 4TMVA 5TNXA 3T95A 3VF6A 4MV0A 3SV3A 2E20A 1OMOA 2OHXA 4H16A 3UJ9A 3SJJA 3ETEA 3GZTB 2E85A 3DEJA 3SLRA 3MAQA 1P8AA 1YR3A 2VJBA 3NHGA 1R59O 1E6KA 1Z83A 3NWBA 4RU1A 2WR8A 3UK7A 2LVBA 1GU1A 2RHCA 3LWBA 1P9WA 3WHKA 3SQ4A 4JHDA 5AQIA 1XHFA 4U9UA 4LF7B 1JHVA 3HK2A 3PC8A 1Z5UA 1V1RA 2EKPA 2IDKA 2OHVA 1CQJB 3KDSE 2PUWA 5KU1A 5L3SB 2HLHA 1G8KA 2JI6A 1BCMA 4GYWA 4LVOA 4LWPA 4ZQEA 3SSMA 3T8YA 3QVTA 4NI5A 3O9VA 2JGIA 1PT6A 4AQYK 1JHDA 4HNAB 2QWLA 4Z86A 4L5BA 4BMXA 4QSMA 1CDEA 2UUAB 3PEYA 3KSDO 4J1TC 3Q7TA 3RS5A 1WZIA 3D6HA 3U3GA 2DPYA 3OICA 2VBIA 3ISJA 3TM4A 3ANTA 4C01A 5ER9A 5I6DA 1YOBA 3VH1A 1HK7A 3OYNA 1J42A 4UTZA 4HRAA 3K9FC 3EIEA 1URPA 3QU9A 4TPKA 4URFA 4U2EA 4B82A 4I46A 3UKJA 3EGWA 5KQDA 3TXAA 4YOXA 3K32A 1H05A 2NTNA 1ZK2A 1GL6A 3N6VA 3OA0A 2I76A 4QRDA 1XMJA 4U1RA 2XUZA 2VCHA 2QG6A 1THGA 3NF8A 3FTNA 1YZFA 4DQSA 4P3OA 5DK4A 3OJFA 1KPIA 4FCVA 2E21A 4OUDB 4Q0MA 5E7MA 4ZI5A 1GL9B 4IUYA 4PYIA 1XA3A 4QQ8A 4I55A 4WOCA 4DTRA 3H2YA 1UZAA 4DDMA 2IHJA 4BXOA 1E94E 1VGRA 3KDAA 1JNXX 4FFOA 4KX3A 4OLFA 1X7WB 2ZPAA 1DINA 3BXXA 3SHVA 5LP6A 3VQEA 2JJYA 3F47A 2C3YA 3AAPA 4NZOA 3RSFA 1KMMA 3JQFA 5CDFE 2NU8A 1AU9A 1WZUA 3LC2O 2FXIA 1ND5A 3EZGA 2UZ1A 5H70A 3OZCA 1K5PA 2FR0A 1N5KA 1KVUA 4L9WA 4X60A 1P9OA 4PG7A 2IUUA 3WV5A 5B58C 2JFBA 3JSAA 1AJEA 4NBWA 1D9ZA 3KZNA 2I7TA 1QLHA 1QVWA 1M0TA 1WSJA 4WHMA 3BY5A 3PD7A 3ASVA 3IUCA 3MW8A 2H3EA 4N6OA 4E12A 3KLOA 1JIKA 2GPSA 2HRBA 2VNAA 4ZQHA 5GZ1A 4ZHQB 5ESRA 4KDEA 1XR3A 4KQWA 5JAIA 1N3IA 4PE5B 5AJ3K 4LQ4A 1CF9A 3TPCA 1FW6A 3BD7A 5LYJA 1NRJB 1TAGA 3NTQA 1NY5A 1UKEA 2O0KA 3V8PA 4B47A 5E3JA 1Q81O 2V1XA 2JKZA 2VWPA 3CURA 4C89A 1T4DA 1J09A 1UF9A 2FZEA 2VQEB 1V5IA 1JALA 1HI9A 2CHGA 2IHNA 2X0IA 3ZGLA 2B9EA 2XA2A 3HCWA 5M3BA 4BKUA 5B7QA 1RZUA 2DTXA 2G0AA 2RKBA 3GXOA 3Q7SA 3W8EA 4KI6A 3S27A 3GEDA 1NV8A 3AQIA 5K3AA 1TYEB 1CFJA 1VTKA 1ZD3A 3IXLA 4FUQA 4IAOA 8ADHA 1M34B 4DU1A 1UPTA 2IBMA 3F8TA 1HF3A 3PQ4A 3RTBA 2QRKA 2X40A 3U39A 5AQZA 3TTFA 4IGEA 1SO8A 3SQ1A 3QEKA 4KVZA 1MJFA 4MIYA 2VJKA 4KREA 2P35A 3KQVA 5LD2C 2V7ZA 1UZMA 4OQFA 3OEYA 4HUGA 5EGSA 4ENVA 4IOXA 2PIDA 3NVKI 1N5MA 1GG9A 1T9GR 2C9BA 2IZ0A 2R6JA 1V8DA 5C1IA 4PC1A 3L0QA 1ZBHA 1IY2A 5KWEA 3RYIB 2X15A 1B8OA 2WINI 3I04A 3SC2A 3AIOA 5HQ3A 1VCHA 3COZA 4FE4A 4MQFA 5I9NA 1J06A 2FZLA 3BP8A 3HCNA 4GLFA 4HDKB 2ZBUA 5CLGA 1T9BA 1BE8A 4IDQA 3FR7A 3USZA 1FPMA 2GV9A 4DPKA 2LE0A 3DMNA 2EEZA 3EVDA 1DTQA 1ZI8A 1E9VA 2AA4A 5JWHA 4FLMA 2BR4A 4O8CA 2V9ZA 3VTHA 1EFTA 1F4VA 3FVVA 1N57A 3QOWA 4J0GA 4M37A 2QORA 2OC4A 4L7QA 1IOLA 1CE8B 5MLCQ 2CFRA 3OHRA 4WY2A 4YJFB 5FWXA 1N2BA 1NKCA 4ZD6A 5DNYB 3GOQA 5AM2A 5HRCA 4C0JA 4EJ6A 3GDWA 1T3TA 4S12A 1XZPA 4E30A 3CIFA 2VJOA 1J20A 3IUMA 1FDRA 3R74A 3U4IA 4ME6A 3COPA 1SA0A 1XTBA 3LF2A 1QFYA 1NGEA 3AILA 2GWJA 1BHQ1 2FMFA 2YJGA 2XQGA 2HV9A 3NANA 3DLRA 1KJNA 1M66A 3A7DA 4NECA 3L77A 4IGIA 1ONPA 4O4LB 3ZDQA 1K9VF 3TQCA 3CIPA 1ZBUA 4CK1A 1FMJA 2BFFB 1O77A 3RHSA 4MWBA 2FPLA 4XLLA 2XQKA 3AMVA 3T7CA 3UMRA 3AGRA 4RMHA 4C2AA 4QUIA 4DJFC 5EINA 1K63A 4M4SA 4MGYR 1ZLXA 5BSFA 2ZS7A 1NW8A 4GMKA 2F9LA 3KCNA 3Q3CA 4FMCF 2X1LA 4KAAA 4XB1A 4O0MA 4YBRA 5EIOA 2J30A 4G4SP 4Y9UA 1XVAA 3V7YA 4CFSA 3V1RA 1C0IA 4PICA 3RS0A 3OLYA 3ODPA 5JROA 3GLTA 2GAAA 5AVWA 4E6PA 4RGYA 5EFOA 1LK0A 1YXMA 4O59O 4RPLA 3DH0A 5DM2A 3S44A 4TLLB 1Q0RA 1WIWA 4NV3A 2HBMA 4G0NA 4ENUA 4BVKA 3K6KA 1KZYC 4S05A 1RI5A 2QZJA 4J29A 2Z04A 1MWMA 1WY7A 1RI4A 3W0LA 4L3OA 1M8FA 1LBSA 4FMDB 2VQFB 1RZRA 2DERA 2D1KA 1ULSA 1P6XA 4JI4K 3NGIA 4MGHA 4OK5A 3KLEA 1GTL1 1X3LA 2NZWA 3K16A 5FROA 1DC5A 2RH5A 2UAGA 3M4NA 3LH5A 4FC6A 4MRMB 4V0KA 4ZO6A 5TF0A 3ROGA 3UWPA 2CF5A 2J9FB 3JD0A 1P8JA 4CJ3A 3SYKA 4DYHA 1TKRA 3W8RA 2R79A 3NFYA 4BLUA 3OFJA 3VGPA 4GI1A 3GRVA 1Q1ZA 2NVWA 3K70B 4LZOA 3FJ1A 4FFSA 4D8YA 4ZDKA 1GN9A 1UEXC 1V3VA 2C98A 3G0BA 3O9SA 1YCGA 3D4BA 3R24A 5FRDA 4IG4A 2JHFA 2Z3VA 3CKMA 3SVTA 5D6OA 3J7AP 3AUTA 4UTNA 3GLIE 1K8RA 1H5UA 3HJHA 4RPGA 1K0FA 4E13A 4RXTA 4BO6A 2H7YA 3OG9A 2CV1A 2NXEA 1U2GC 2QTBA 2W6ID 4X6UA 5HG0A 4Q3CA 4ENSA 1HEIA 1I32A 2V51B 1PVDA 3TAQA 1WMDA 4GNIA 4QOZB 3CFPA 1XDWA 3AINA 3K9WA 3MWJA 4QO8A 3UA4A 3GDOA 3AHJA 4I19A 2VG5A 2ZRBA 1JHYA 2J7PA 5EQTA 3VETA 3NE6A 3DMHA 4IX9A 1BROA 1EE9A 1VA5A 1GRVA 1Y4DE 3O7XA 2VJMB 3KQQA 4HFJA 4OP3A 3SX4A 2A78A 3TWHA 5H59A 1TKDA 2CLSA 2OT3B 3MAGA 1KI1A 4IIBA 3BUZB 1PU2A 3Q1KA 4Q7LA 2NVBA 1M8PA 3S3NA 1ZC3A 3AJAA 5EJMA 3K8ZA 2R44A 3E2PA 3IOBA 1H2AS 3AUKA 3BWBA 3RS8A 1ATZA 4AILC 2P6NA 4RNDB 1BG6A 5EVJA 2QTFA 5H80A 3D2EB 4IJMA 5LXTF 1Z3IX 4Y9SA 2W2KA 3LOPA 3O08A 1TK5A 1ZM9A 2PBZA 1Z26A 3DJFA 4JL5A 4P1ZA 1TJNA 2TMDA 3GEIA 4P9NA 4RX1A 4WK6A 4OHOA 5BN5B 4ALKA 5JFGA 2ZSKA 1EXMA 1GTMA 1RS0A 1TKCA 3BEDA 3QYFA 2YVAA 1YBMA 4WBNB 4B6GA 3J7YP 1IHUA 4ARAA 1FKOA 2JGNA 4IZHA 3ZWVA 5HBGA 4O4IF 4QU9A 4DCJA 4W9NA 1YZLA 1YDHA 4FI3F 4POAA 1H2XA 2I9KA 3BF1A 1G6KA 1SHUX 1ZBLA 1P3JA 1Q16A 2VNIA 3L01A 3PQFA 4R9NA 1YRYE 1IQUA 2X76A 3FYUA 4BO0A 5IARA 4BQQA 5A0FA 2I2WA 2VAPA 3QBJA 3S2YA 4JKEA 5MGNA 3GLHB 3F49S 3R3UA 2HHJA 3DULA 1K73O 2VHWA 1KZ6A 1U7DA 3B6KA 1P60A 3DYBA 1OH7A 3F8WA 1UXKA 3EARA 4ALNA 1OD6A 3P9YA 1NUTA 1WMEA 3EXEB 4L8WB 4QBFA 1KU0A 4UNPA 5TLSA 3AVUA 3PUFA 4IQ4A 2YJFA 4BB9A 2Q1WA 3O8LA 5SYMA 3REOA 3K0BA 5ALGA 1T34A 4DV4B 2G04A 1NVEA 3AETA 4LXXA 3S2UA 3CVOA 2Z3WA 1KEEB 2ODPA 3H83A 5C2JB 3BB1A 3H1TA 2XE8A 4RPKA 3WO1A 4Q47A 1DSSG 4ZZ3A 2A59A 1GZHB 1L8AA 1SY7A 3DNMA 1GILA 2FWIA 1N2CA 4BMDA 1LTKA 4F85A 2AUNA 3UK6A 1WHSA 3H9BA 3FYSA 3IP7A 3NTOA 1XEWY 2HMPA 3Q1LA 1VB5A 3FDZB 3MT8A 4MK4A 2BM8A 1IN5A 1WXDA 1HH4A 2OPPA 1SKRA 2WHPB 4OYHA 2FFBA 2ZIAA 4R5MA 4WLOA 2GK6A 1KH3A 4HI0E 1D6MA 1OI3A 3C1OA 1W76A 1IC6A 4MUYA 1XAIA 2M2IA 4CHOA 3NTLA 5HK8A 3FUXA 2ONJA 3V7WA 4NJEB 5BPFA 5JCOC 1AHIA 1T26A 2V9CA 3DVAA 3E9CA 3ELUA 4GZ6A 5C81A 2ANBA 4MLEA 3NTVA 3SQOA 4CF4A 4YUYA 1SCQA 5C4IA 2CNKA 2NT3A 2YI1A 2YMLA 4JDPA 5ENZA 3T7JA 3O5AA 3BDAA 3M6VA 2VN8A 4QG7A 5CPBA 1EP1B 4OH1A 1FQOA 2GK4A 5FTKA 5H8WA 4ENTA 4LCEA 4NZNA 1Q1AA 1RRPA 4TMFA 1LNSA 1XKTA 2PQ0A 5JO0A 1U8CB 1YTLA 1HDYA 2QQ5A 4C0QC 4BNMA 2ZIFA 2BHLA 1A77A 2GJSA 4KH4A 3LPMA 4FLVA 4X61A 5EJAA 1H4VB 2LCFA 3HWWA 2B3TA 5J5AA 4F4JA 1FJXA 3T69A 3MT7A 4NE7A 1E2UA 2BUAA 5CNIA 5D51S 4BBPA 4IQGA 3QKTA 4LI3X 3DLTA 4H7PA 3BL8A 2ZJZA 4UDOA 1OA0A 3MGBA 3UFXA 4DA7A 2OZEA 3N8GA 2J0EA 2LV8A 4KQ1A 3RREA 4H5NA 4WNYA 5KQSA 2WC9A 4A6EA 1F17A 4HGYA 4ZQBA 5JSFA 2XTZA 4MTCA 1UBOS 4PINA 2G72A 3LGAA 3OWHA 3LF1A 1F60A 5I7VA 1NT2A 3TFWA 2EKDA 1HNNA 1A3CA 4BNFA 4WZBE 2QI2A 2VR1A 3HR8A 4KGZA 4DQLA 1PBTA 2W98A 2H1SA 5AQUA 3G8AA 1HL7A 1T2CA 4QJIA 1JR6A 1YCHA 3SNHA 1CJUC 2R751 2VYVD 4XW2A 4W6QA 3OZTA 3TSYA 3DXYA 2H1HA 5IW8A 3QELB 4OL9A 2LIVA 2PJDA 1JXMA 3LZCA 3T5BA 3TIVA 5HKKD 3M5CA 4DC0A 5LZ8A 2HA4A 4AJKA 4BDTA 1ZL0A 1K98A 4RL6A 4TRJA 2VNKA 1NWHA 1N2OA 4LQDA 4TTIA 4C6HA 4ZGBA 2A1SA 1FE8A 2CMGA 3IVRA 4B9SA 4IJKA 3AGKA 4RFSB 5ALEA 3ZW8A 3S2EA 3LAMA 4RYDA 3RSHA 2G7MC 2VWBA 4EGJA 1OWMA 1DIBA 4UD6A 2OM2A 3SZMA 1JCEA 2AMYA 2VAXA 3VSBA 5JBNA 1OY1A 1XVUA 1ZJJA 4ZREA 1EU1A 3O4JA 5LBUA 4JYPA 4NZMA 4F4IA 1V2GA 1QIGA 4Y6PA 5GGXA 3ZXIA 4QM7A 3U44A 3A04A 1ORVA 4MCHA 4IVQA 3R7SA 3GLFB 3ADOA 4L7VA 2FMIA 3Q40A 3GHYA 3ICQB 1PUJA 1Z8NA 3QXSA 4LXIA 4YJHB 1M6EX 3OFVA 2M6KA 3RHZA 3LLVA 3KYJB 5TSDA 4CCHA 3CZCA 1YACA 3GJ4A 3ND7A 5FOSA 3KZMA 3SE0A 3DKRA 2D7JA 4EYKA 3KXIA 2I6SA 3UMYA 3A3NA 2A57A 4HDQB 1B3RA 3V7UA 3CCVN 1S72N 4PY5A 1K1EA 3LBHA 1CCWA 3P96A 1IOVA 1OX4A 2GPAA 1UA1A 3WK4A 2JCYA 1TAUA 2PFKA 4CI0B 3T1HK 3DWFA 2DUUA 2AJBA 3QVMA 4DCOA 1KORA 3I61A 3UJAA 3FBWA 1MW8X 1A50B 3JV7A 4HXEB 5CH3A 3SQXA 3LL4A 2Q5QA 2DULA 1DTWA 1I9CA 4UVHA 2XEDA 4PTZA 1UWBA 1TQ4A 1KTQA 4AHCA 1ZGBA 2WYHA 2CZCA 1DFGA 2W2QA 4BQIA 2C3OA 4OGGA 3SWWA 1DE0A 1Y9EA 4BAGA 2G8FA 1LPMA 2IV7A 4QO7A 4R1LA 5B3JC 2QXFA 3A4YA 4A2CA 1UEJA 4UBLA 1UMCB 4CW7B 2VLBA 2B8EA 2AC2A 2XDAA 5CHIA 4G8JA 2FOXA 2K7ZA 3IMKA 4HH3C 5AQNA 2SKEA 3MGCA 4O5AA 4XGIA 4DBZA 4E08A 4Z51A 5CDGA 4DFJA 4YCNA 2XUHA 3KSAC 5FWAA 1DJNA 4EB8A 1VG8A 3JS5A 4YJ2B 1W4ZA 4RJLA 2VG8A 4QIHA 2ZJ1A 4MYSA 4OHWA 3EQ2A 4FFLA 2VS1A 1YVDA 1AKTA 1BXRB 3A6LA 5LLSA 1N77A 4JI4B 2VF2A 4TS3A 3TK1A 1SXQA 2RAFA 1VLMA 4OBEA 1K06A 1PR5A 4CL2A 4HL6A 4XUEA 4WQ4C 3BPSA 1L7MA 3QPVA 4R3UC 1XUPO 4YHBA 5JNLA 3STWA 1YKFA 3NOXA 4HDRB 4CMKA 4DFPA 5B30A 4P3PA 5AO9A 2V7QD 4KN5A 2HGSA 4P53A 4Y2PA 1BJKA 4FONA 2W70A 2PT6A 2IH4A 2DBZA 3HRGA 3MLAA 1W93A 1YJQA 4M1QA 3WK8A 4UJ5A 3V4SA 4H0FA 2VHTA 3BICA 3H4MA 3RE1A 3NBUA 3UJBA 1WZNA 5CXUA 3GEBA 1ZA1A 2V7PA 1JI0A 2FU5C 1AZTA 2FPIA 4EX6A 3RVNA 3W0LB 4DUYB 3CRW1 3RVOA 3KB6A 2CLEB 2QL6A 2PJUA 3NVMA 1ODSA 5ECWA 4ZFNA 2OUIA 2YV3A 1NI4A 3OIDA 3BKXA 1VMIA 4F8RA 2DQKA 2WPNA 4M87A 5FBKA 4CEOA 4HNVA 1HFKA 4ALIA 2Q6LA 1EXWA 3R5JA 1KYYA 1MVLA 1OBVA 2BGMA 4M54A 5KAMA 3TKLA 4NV1A 1P75A 4CFCA 1TADA 3DMDA 3EE9A 3ET4A 3LWZA 2Y92A 2H5JA 3FVQA 4I50B 2VBFA 1M2FA 5AOAA 1U7TA 1RT1A 1U2VB 1N5DA 2PH5A 3U16A 5KMGA 1VQON 4W63A 3BRCA 3N2GB 3QOYA 1J5OA 3UKDA 3ZY4A 1E6MA 5ELXA 4Y2YA 1D8AA 1QOPB 4ARZA 1XU4A 1IJFA 4UARA 3EGIA 1EWTA 3WBKA 3DAGA 2AB0A 1J99A 3HPRA 5CDYA 2C77A 4ZRNA 3AEKA 2NRWA 2P2YA 4CCSA 1NNI1 2RC5A 1KK3A 3PXAA 3ZTYA 2UUCB 4QVKA 1FLNA 1W6RA 3OAAD 5BSGA 4RXUA 1IEXA 4RGQA 3LBFA 3KD3A 2B92A 4JP2A 1D9XA 4GC9A 4JLJA 1P0CA 5EESA 4IHKA 4RGBA 2P5GA 1QCZA 4JVOA 1J39A 3OQIA 1H0KA 1THZA 2NX2A 5JXJA 3R5SA 1XZFA 3RROA 3T4UA 3EQ8A 1ORWA 3W90A 1CQWA 2I2BA 4HDNB 4FWKA 3P9RA 1O7JA 2X0FA 4MQLA 5FD8A 3QUBA 2A5LA 3CIOA 3BMXA 3KV1A 4OQXA 3SZ3A 3BXZA 2PYIA 1LBIA 4MHTA 2PRKA 2XUJA 5DFAA 4HBZA 1P7YA 4XQGA 3WXJA 2MIIA 4UQPA 1Q7RA 3DFKA 4CZ2A 3TIXB 3WS7A 2BEUA 4QREA 2W2KB 5BQPA 3O3MB 3UB3A 4CTKA 4MITA 1SBYA 1QHXA 1W2WB 3RTGA 4QVIA 3HGMA 2QVYX 2LCQA 1LBTA 4KWEA 4MS4A 3DV2A 1JLRA 1E2JA 1ZNZA 2WP8J 3DE3X 3CLRC 3P2KA 2PX6A 3L41A 4BN5A 5BQXA 2C3UA 2E2NA 4P86A 1KHHA 2Z5GA 2FSNA 2UUAK 3QSGA 2C03A 4MPRA 4ZYTA 4OK3A 4FI3C 2Y1LA 4HTFA 3ZJUA 3HDHA 4DIBA 2BONA 1PQYA 1ZIDA 3JQ6A 3NH2A 2OM6A 4M3YA 1XZNA 2I9PA 2QG4A 5F35A 4DARA 1GR1A 3KT8A 4Q4HA 1U6JA 2YDXA 4H9GA 1P0MA 3M6IA 4OQPA 1FJHA 2QMZA 5FOXA 3GFSA 5GP1A 2YX1A 1NSFA 1CIPA 1CNMA 1C0GA 2GBFA 1EFVA 3GAFA 1L5VA 3CXUA 1FTYA 4M60A 4MYUA 1MA3A 5DBOA 1SVIA 4FOIA 2ECPA 2GRJA 1NQ5A 3KHKA 3WQQA 1IMJA 2AYXA 1XXLA 5FTJA 3VYWA 4I3FA 3T1AA 3WOVA 2H07A 1UAAA 3KJGA 3DF9A 3HWSA 2DPLA 2PVCA 1DKRA 4BRPA 2MR5A 2AK2A 2HHAA 4MUGA 4XARA 3ENNA 2OZKA 5B1IA 4AJOA 4JKBA 1E77A 1EHCA 4FLTA 2EXXA 3IERA 4J2HA 3ZWBA 3EFOA 4DV1K 5AWFC 1KAMA 2D5CA 1LC0A 3O4VA 4QAGA 2ZYDA 4IVPA 3PGA1 3W5HA 3IXMA 1JLFA 1KXPA 1X94A 1NIJA 1WKVA 2AVDA 4JVNA 5DGCA 5KTYA 1DEKA 2ZT5A 3DF7A 5LVAA 4R68A 3JQ9A 3PD0A 4KO8A 2Q1SA 2J09A 4ZAGA 1YMQA 3D2BA 3BMOB 1WOYA 4FQ8A 3WV4A 1EUZA 1B76A 1BN6A 1DAEA 2J0VA 3JY6A 4D6XA 5JD5A 2UYHA 4FBMA 3WMEA 3ITDA 3PYXA 5JQGB 2Q29A 3QBWA 1U0NA 3EAFA 2ZRQA 4XEHA 4EGQA 3U1BA 5CDSA 2WTNA 4AROA 3HB4X 1XZQA 2D5IA 4OX9B 3L6QA 3TNLA 3OEED 3Q9NA 4BVBA 3O91A 4EJFA 5L53A 3TWOA 4WJZA 3AARA 1WUKS 1S3GA 4MDYA 3SAGA 3QIRA 1SPXA 1YCDA 3QKRB 4QPJC 3LDNA 3SOPA 4B80A 3IBTA 1MDFA 2YXLA 3V34A 5AQVA 2QZZA 5K09A 4EIAA 3MUNA 3L40A 1NMNA 4WINA 3I76A 1Q1EA 3L5OA 3PUKA 3RKSA 4DXAA 4X1KA 5D7NA 4OFBA 4Q4AB 3ZSVA 1RC8A 3CN9A 3W9UA 4U7JA 4ETIA 2CLLB 2I8LA 1WXFA 4RDHA 1JYEA 3VQCA 4R8RA 3X2FA 4G1UC 2I2CA 2D0PA 5KYNA 5KMGB 3WRWA 4IINA 5ER6A 3VU0A 4RIEA 4YRPA 3NEJA 3TSZA 4ZTZB 5I9IA 1OFTA 1BCRA 1JRLA 5CM9C 1RHUA 2ATIA 4D0NA 5CBPA 1QPBA 1BW9A 2FUG6 2QPTA 3I5UA 1ES9A 5KNDD 2M98A 3CZRA 4FWPA 1J2YA 2VQ6A 1VRUA 2YC4C 1EETA 4KFRA 3LQ4A 1P1BA 1I1QB 1IBCA 1X2BA 1I4EB 2VHCA 2QKYA 2XWQA 2ZGYA 4KU4A 2YJ6A 4BWVA 3RD5A 3ORSA 4HS9A 4MS1B 4CE9A 3R0XA 2K4MA 3BERA 4AG5A 1Z9BA 4A62A 1CZKA 4J4BA 2R2GA 1KK2A 2BFBA 1P1FA 1RBVA 2F43A 2F48A 2IYSA 4KYIB 4H7FA 4OHBA 1SOWA 1WOQA 3A4VA 1RE0A 3H9JA 3L7OA 3EX7C 4C4XA 4X00A 1QP7A 2B78A 4FGKA 4JHLA 3VGKA 1BX3A 2H31A 2NZJA 2XBLA 4OUDA 1HKUA 2JIRA 3I92A 2QP3A 1GDHA 3E03A 1T6YA 1Z75A 2QLLA 2W90A 2Z4RA 4ENQA 3ZVNA 5I7HA 5AXCA 5EJFA 3IQFA 4TXHA 1JEQB 1T5LA 2XUFA 1JXOA 4KVAA 4WOBA 3O8OA 3FNEA 2IU0A 2JH8A 4RHFA 3IVAA 3SUPA 1QWSA 1IONA 1XMVA 3LP1A 1Z6GA 3HS3A 4KJZA 4UU8A 1FK8A 3BGSA 4L27A 4N7JA 2GJ8A 2PWAA 3W78A 3EIWA 4XVUA 3C4VA 4QYMA 3IAM6 5ELMA 3QBEA 3N7UA 1ESZA 4E5UA 4IFVA 3EDRA 4DCUA 1TEXA 4RNCA 4A8JC 1E1LA 1A88A 1IKYA 4O4HB 4QRIA 5B1DA 1FZQA 1CUVA 3AUFA 3LS2A 3NM5A 3O84A 1L3SA 4XIGS 1Z8HA 5H9VA 1AO0A 2ZJRL 1YK0A 4LBVA 1LPOA 1DMSA 1W48A 1C9MA 2H4ZA 2O0JA 3INNA 4L57A 4IDKA 5KTQA 3FZNA 2CUNA 3R3JA 4KDFA 4LJSA 3CMCO 4F3CA 5C52B 1ZAYA 2AFRA 1OFUX 2VPZA 2PMFA 2FF5A 4V3CA 1KE2A 3VHLB 4C88A 4OGLA 5BXYA 5EPEA 1O2DA 2DX7A 4QPDA 3H8JA 4CNBA 2I1QA 1RWMA 2Z9DA 4MZDA 2HN9A 3ZU2A 4K9DA 3PNLA 1KP3A 1F6DA 2H11A 4BNGA 1OA1A 1UXIA 1R6XA 2P5SA 1P7ZA 4WDQA 3S3TA 1KNQA 3G88A 1JJ2M 2GGSA 2R7KA 1NGHA 1NP6A 1UL1X 1TUIA 3HPGA 2DLNA 2PRIA 3GUUA 2ZE5A 4DWWA 1DGQA 2V45A 3LUGA 5AHWA 1CZOA 1Z3CA 3PUHA 4I81A 1W88B 5H3HA 4LF6B 2V6FA 4J0CA 3EGDA 1A97A 3KOOA 2XA1A 2YIVX 1WPRA 1M1YB 3RTVA 5FPDA 1AGYA 3TBHA 3WJAA 1P90A 1J54A 3ZVLA 4BO8A 5IJ0A 1RKXA 1XNHA 2AMJA 2Y1GA 4Y9TA 1G4AE 1QZ3A 2Q5IA 2X2OA 3BS4A 3IP6A 2PKXA 4YJ3F 3WGTA 4FFVA 4R8KA 4P5DA 5BMVF 4DQRA 4NBVA 1FS6A 3IAAA 3GBVA 4G1BA 3UENA 3KQUA 3AVTA 1REVA 2VT2A 3HJCA 1BFUA 3KC2A 3PUYA 5CT6A 1N6LA 5LP1A 4BQOA 4Q9IA 3FR8A 3HI6A 2ASEA 5KYXA 3G85A 2FPPA 2IOQA 4MNTA 1FRQA 1H3FA 5JMTA 4YP5A 1PUXA 3B5EA 3EGCA 3QW4B 3IE1A 4MUEA 1CF4A 1Z5PA 1CXUA 3NORA 1GZVA 1I0ZA 4I9LA 3QMWA 1R9MA 3KAKA 4Z0HO 4DBLE 3H1FA 4DV7K 4AP9A 5IM4A 2B34A 4JBIA 3MX5A 3OT1A 4RKRA 2DUJA 3OS2A 2VJAA 4JSTA 4XB2A 3R7AA 1V5WA 1BX0A 5I7UA 1IY8A 2MU1A 4E89A 4IIDA 1GZ4A 4X1KB 1IL0A 4GZLA 1F2TB 1SR8A 1RQNA 3A3KA 1GPKA 5BR7A 4Q5VA 2IYZA 3NONA 3HYLA 2KLAA