5T7BA

Argonaute-2 - 5'-(e)-vinylphosphonate 2'-o-methyl-uridine modified mrttr guide rna complex
Total Genus 227
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively.

Total Genus
227
sequence length
837
structure length
802
Chain Sequence
FKPPPRPDFGTSGRTIKLQANFFEMDIPKIDIYHYELDIKPEKCPRRVNREIVEHMVQHFKTQIFGDRKPVFDGRKNLYTAMPLPIGRDKVELEVTLPIFKVSIKWVSCVSLQALHDALSGRLPSVPFETIQALDVVMRHLPSMRYTPVGRSFFTASSNPLGGGREVWFGFHQSVRPSLWKMMLNIDVSATAFYKAQPVIEFVCEVLDFKSIEKPLTDSQRVKFTKEIKGLKVEITHCKRKYRVCNVTRRPASHQTFPLQQESGQTVECTVAQYFKDRHKLVLRYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIRATARSAPDRQEEISKLMRSASFNTDPYVREFGIMVKDEMTDVTGRVLQPPSILYGGRNKAIATPVQGVWDMRNKQFHTGIEIKVWAIACFAPQRQCTEVHLKSFTEQLRKISRDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYAGLQLVVVILPGKTPVYAEVKRVGDTVLGMATQCVQMKNVQRTTPQTLSNLCLKINVKLGGVNNILLPQGRPPVFQQPVIFLGANVTHPPKKPSIAAVVGSMDAHPNRYCATVRVQQHRQEIIQDLAAMVRELLIQFYKSTRFKPTRIIFYRNGVSEGQFQQVLHHELLAIREACIKLEKDYQPGITFIVVQKRHHTRLFCTDKNERVGKSGNIPAGTTVDTKITHPTEFDFYLCSHAGIQGTSRPSHYHVLWDDNRFSSDELQILTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKRDHQALAKAVQVHQDTLRTMYFA
Loading diagram...

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

publication title Protein structure
rcsb
source organism Homo sapiens
molecule tags Hydrolase/rna
molecule keywords RNA (UVP)UAUAGAGCAAGAACACUGUU
total genus 227
structure length 802
sequence length 837
ec nomenclature ec 3.1.26.n2: Argonaute-2.
pdb deposition date 2016-09-02

pfam database annotations

chain Pfam Accession Code Pfam Family Identifier Pfam Description
A PF02170 PAZ PAZ domain
A PF02171 Piwi Piwi domain
A PF08699 ArgoL1 Argonaute linker 1 domain
A PF16486 ArgoN N-terminal domain of argonaute
A PF16487 ArgoMid Mid domain of argonaute
A PF16488 ArgoL2 Argonaute linker 2 domain
Image from the rcsb pdb (www.rcsb.org)
cath code
ClassArchitectureTopologyHomologyDomain
2.170.260.10 Mainly Beta Beta Complex paz domain paz domain 5t7bA02
3.30.420.10 Alpha Beta 2-Layer Sandwich Nucleotidyltransferase; domain 5 Ribonuclease H-like superfamily/Ribonuclease H 5t7bA04
3.40.50.2300 Alpha Beta 3-Layer(aba) Sandwich Rossmann fold Rossmann fold 5t7bA03
5TE9A 4XLTA 1PHRA 2LUOA 1JBEA 3LWLA 4OPJA 4RKRA 3O4NA 2FW0A 4ML3A 4MQFB 2YNGA 4FM1A 1VRUA 4RU1A 1J5OA 3TD9A 4JRQA 4HCCA 3AVBA 1RT1A 1L5UA 4KHUA 1P2FA 1SI3A 3DLHA 4GVMA 4MQ3A 1JLBA 2FKAA 5HBMA 2VUIB 1Z25A 4Z9AA 2E4WA 4OLBA 4PQUA 1JWLA 3L2UA 5EWJA 2I6FA 3QEPA 4KB1A 1ISRA 3U3GA 3CFYA 1RDAA 2JRLA 4G0OA 3D02A 4QAGA 4DSEA 2X74A 1SL1A 1Z16A 1RZRA 4DTPA 3OO1A 3QEIA 3OMWA 3AO3A 1G15A 3DMJA 4WWHA 2YNIA 3SZ2A 4MFBA 1HYZA 1EWVA 4JAVC 5CZ2A 3MM4A 5KRSA 1DG9A 1TV6A 3VQ7A 1S8NA 4FLYA 3AVGA 4BDPA 2HJ9A 1N6QA 4YCSA 4LY7A 3KSMA 4ETMA 4FJHA 1L3SA 2R48A 5HQJA 4CJRA 4CFCA 4EYKA 3RVSA 1XWWA 2R4QA 4FK4A 2HB5A 4CK2A 3NBMA 4DLEA 1L3TA 1N5YA 2HHQA 5KRTA 3KLNA 1EWTA 4G86A 3OYEA 2PUFA 3HSTB 3OLZA 3QEKA 1MAVA 4E0DA 5KI6A 3CTPA 1RPJA 1RILA 3NNDA 1S1VA 3AVFA 2HMIA 4MYRA 3PX6A 1UOCA 4KI6A 1BIZA 2FVYA 1JLFA 3MYYA 4RK4A 1S9GA 4FE7A 3DLGA 3SYZA 4MRMA 1YVUA 4XASA 4Q5VA 2XY8A 3HM9A 5EWMB 4IKFA 4EYQA 3PUFA 2LBPA 2NZVG 4E7IA 4DSFA 3P5JA 4CJ3A 1CYEA 4YLEA 4HUGA 1Y97A 3JVDA 1RTHA 3ZSRA 2FEWB 4Z99A 2OENG 1IKYA 1LV5A 1USGA 4E19A 1M2EA 2FBVA 4J2BA 4GW6A 1TLFA 2GV9A 1GOCA 1Q9XA 1YIOA 3LZIA 4MR9A 4EYGA 3M9XA 1W25A 3OS0A 2D0CA 3NF6A 3NF9A 4Z0UA 4B9SA 3T19A 3N0RA 4CJPA 3PV8A 3G10A 1IKXA 1RBRA 3EAFA 1S5JA 4RZSA 2KZMA 1S1XA 3LTEA 5BRAA 5I4CA 4DS5A 2RKIA 3JPYA 2FBXA 4W5TA 1Z13A 2O20A 3CQ8A 4KKOA 2PZSA 4E1NA 3SQ4A 4CEZA 3ISNC 1JFTA 2Y1JA 4F2SA 3HDVA 9ABPA 4MQFA 2RF2A 3RMDA 1X9MA 3SY8A 4H4OA 4CF9A 3JY6A 1TGOA 3CZ5A 3N0XA 2J48A 4DN6A 1RZRD 3LUGA 2FXIA 5TPWA 4RG8A 5FWXA 3H5WA 1SXIA 1TK0A 4DTUA 3IAYA 3P83D 4DQSA 4KHQA 4M42A 1HYSA 3OLYA 1NOYA 4W5NA 3L49A 1DTTA 1JLAA 1JF8A 1IIBA 3ROTA 1H9CA 2D0BA 3IPCA 4G97A 1PUXA 2MSKA 4WZZA 3T1AA 2FQYA 3VQEA 1TAQA 3K5OA 3F6PA 1GCGA 3NH2A 5J2MA 2QSJA 4HYEA 3IPAA 4RW6A 4CFDA 2DTUA 3P9YA 3FFTA 5J2PA 5I42A 1F4VA 3D8UA 3OYMA 2BE2A 3HDGA 2L5CA 3NFAA 4QPJC 3IRXA 4CF0A 3Q7RA 1TVRA 4XIUA 1UDRA 3HL8A 1HMVA 3QK7A 2PL9A 2OPRA 5KQPA 1VSIA 3DLRA 1RCHA 2HNYA 3V1OA 4DU3A 4CIGA 5HRSA 1DRJA 4KO0A 1ASWA 4QCLA 4LZLA 2KQ2A 4CJEA 4Y9TA 4W5OA 5SWMA 5DK5A 3BGRA 3TMYA 1CZBA 4FJIA 3RVPA 4CFAA 3MECA 2F8SA 2P9HA 1REVA 2E4UA 2YKMA 1D4ZA 2Z1JA 2DFEA 1FSPA 4M3RA 3OYFA 1E6LA 2HVIA 1DP4A 2XFMA 6ABPA 3THVA 4B9UA 5E41A 2QK9A 1Z15A 2FQXA 1ZYQA 3DI6A 3I0SA 5PNTA 1ZBLA 1RNHA 1RT2A 3RMAA 2JB9A 4ELUA 4CJSA 3QNNA 4MRMB 3WNHA 1FFWA 2A1RA 1QO0D 4MR9B 4PE5B 3QX9A 3IS9A 4F11A 3JS5A 4FM2A 1NXTA 1D1QA 1JHZA 1KCFA 1JLQA 3KK1A 1VRVA 1TAUA 3V1QA 4Q6WA 2XDYA 5FWYB 3HYFA 3ITHA 1MB0A 1ZGZA 4KV7A 4F8JA 3HEBA 4GPAA 5FRNA 2FQWA 3K57A 4LX8A 4FLVA 3SNNA 1RNLA 2PLNA 1NKEA 2HQRA 3HP9A 2NT3A 3RH0A 3MMNA 3QEXA 1URPA 4CHOA 3M8SA 4FLTA 4DQRA 2FEPA 3HCWA 2DFHA 4Q7EA 5KWSA 3TO5A 5IC5A 4OBBA 4PY5A 4RW7A 1TVMA 4MR7B 5HRNA 1O1WA 3MEEA 5HLFA 4AHSA 4IMIB 1K66A 4CERA 3V9SA 3DZDA 3QLVA 3T95A 3AA2A 1QP4A 3T8YA 4E7LA 4HNSA 2E4LA 4B09A 3DGEC 4E3SA 4N76A 4E1MA 3VQ5A 4RY0A 1ZBFA 2G8KA 4NYFA 2FEKA 1HQEA 1S6QA 4F4KA 3MA0A 2ETJA 4KFCA 4ZMRA 2A9OA 3O6EX 3ZT2A 2IDMA 3QERA 4G0QA 2RDMA 5KQMA 1TK5A 1VPWA 3RTVA 5EWLB 1WN7A 1P8AA 3RVNA 4CE9A 3HVRA 1PNTA 3M9WA 1OXKB 4JS5A 1KMIY 2L17A 4KRFA 1D9DA 3PO4A 1DLOA 4FM0A 2AJQA 3HK2A 4GMJB 1J9AA 3M6MD 3SUNA 1JH9A 5CNIA 2E6LA 5EWMA 3QIOA 4NGCA 2KYRA 4HCBA 2H0AA 5T3YA 2OPPA 5C42A 4DTXA 1HYVA 1QPZA 3KLFA 5B3JA 3MXIA 7ABPA 4KQCA 1VYNA 3AVAA 1T7PA 3JVIA 5BR1A 3FFIA 1RT3A 1ZN2A 4G0XA 3ZT4A 2QV0A 4Y1DA 2HHVA 4ZTFA 3SPZA 4NH6A 5GOTA 1QHTA 3RMCA 1JDPA 1KVCA 4FJGA 2X7XA 1KRWA 4JA2A 4NV3A 4D6YA 3G0ZA 2M98A 5TQ0A 3B6PA 4CJVA 3AO5A 1SI2A 3CLKA 3O2JA 1SXHA 3KK2A 2LPMA 2P51A 1QQBA 3V9ZA 3O3FA 4NGDA 3QETA 2QVGA 2L18A 3NBPA 5IX8A 1KVAA 5DCLA 2WRZA 2KZZA 2TMYA 2IGIA 1XHZA 1MU2A 4EVRA 3S99A 1T8EA 4CIFA 4TLMB 3WNGA 4B9MA 4FJ7A 3RMBA 1IO2A 3ZT1A 2IPAB 3I42A 2HHUA 5J1EA 1GOAA 3SPYA 1D5AA 4PWDA 2YNFA 3TAEA 1D8YA 3KLOA 3KS9A 1PEAA 3CM6A 1XHXA 4EP4A 4HNRA 3DGFC 4OJRA 4BWJA 2PUEA 4I9LA 1BHLA 5BRJA 1E2BA 2PUDA 3SQ2A 4FJ8A 4LH5A 1EXQA 4AHVA 1SD5A 3KD1E 3LUHA 3OYGA 5TQ0B 2B6AA 1SV5A 1SUQA 1T05A 3S9HA 4EZ9A 2IYNA 4AHTA 3OYAA 1NJYA 3C95A 4CJFA 2ID7A 2WOMA 2JLEA 1DC8A 1JXBA 2F8TA 3KCNA 4FLUA 4F3OA 3HT3A 3AVLA 4IMJB 4N0QA 1WAFA 3DLBA 1WAJA 4CEQA 3DRPA 2PMCA 4KHNA 5JNSA 1L3UA 4MGEA 3MQ4A 1C0EA 4EGSA 3KK3A 4I2QA 1NXSA 3O7VX 1JLKA 3CU5A 3L3UA 3KG2A 4FLXA 3B2NA 1ZESA 2B4AA 5KGXA 3O2QB 4O5BA 1AB5A 1ABFA 5TPZD 1Z17A 2XY6A 4AHRA 1K68A 1C1CA 1BQMA 3E01A 3A2FA 2FSPA 5FDLA 1NK4A 3UK0A 3H6GA 1TKZA 2FTKE 3FGZA 3QLUA 4ZYLA 3CM5A 1Z26A 3OMXA 3IP5A 1OXBB 2EHGA 3MXJA 4KVFA 5EU7A 4M3WA 2IOYA 3DLKA 2JCGA 3LAMA 4MR7A 1Z12A 3MAQA 2CHEA 1F21A 4MQEB 1LJUA 4D74A 3CZCA 1ITGA 3VNBA 4CGJA 4CGFA 3LUAA 1NTRA 3D0PA 5TQJA 4CHYA 1DCFA 2Z1IA 4XXHA 1S1UA 1ZY2A 4DQDA 3N75A 3V1RA 6CHYA 1QQCA 5CZ1A 1UWBA 1BCOA 2BDPA 4QOZB 2A1SA 5DMRA 3NGZA 3IP7A 1SL2A 1YS7A 3VQ6A 1C0TA 2P5OA 3H75A 1RBUA 2OQRA 1BI4B 2OZSA 3U6FA 3G85A 3DRSA 3QIPA 3T6KA 4FJLA 4DTJA 3CFRA 3HVTA 1U45A 2HSGA 2VG7A 3ZSZA 3RVRA 5FBKA 1WSJA 2NT4A 4B8AB 4DSIA 1TMYA 3VA0A 4EZ6A 5HKOA 5KC9A 5D2CA 4FJXA 1ZH4A 4NCGA 3SV4A 4ZPJA 1FXXA 3H1FA 2E4VA 3WNFA 1NXWA 4C8LA 4BACA 4C8KA 4YNQA 5IUNC 3HPHA 2FN9A 2IPMA 1YT3A 4RW8A 4AHCA 3OYJA 3RR7A 3K58A 4FJNA 1JYEA 3NE6A 3G1WA 2GWRA 2EX3A 3JTEA 1QQAA 2QKBA 4UHJA 4FYDA 4DMNA 4CJKA 1NJWA 3LWMA 5IEJA 3EULA 3H1GA 4FK2A 1YMVA 3O1HB 1NJXA 4MS3A 2E4ZA 1B92A 4CJLA 1WETA 1VKRA 2B1JA 4YWHA 4ID5A 2B4JA 4M3UA 1HJRA 1HEYA 3KHTA 2KW4A 5KGWA 4IILA 3ALYA 1VSJA 4BDYA 3ZSVA 2VWJA 4CJTA 1QP7A 1YK1A 1KLNA 1KTQA 4QICA 3OS2A 1LW2A 3AVIA 3V9XA 3RQIA 4RK5A 1RT6A 3NF8A 4YP9A 4OATA 3KYIB 1ZVVA 3QNOA 2G8UA 1S1TA 1BGXT 1TK8A 1YS6A 3K4HA 3DOLA 4DU1A 3K9CA 4IGAA 1QMPA 4EY3A 4E7HA 4KTZA 2E6MA 4RK6A 2OPQA 1WSGA 4B9LA 1BAPA 3HPGA 3L2VA 3NDKA 4KNYA 4NHAA 3C6QA 4CHPA 1VSKA 3FFXA 2QKKA 3OM0A 3OJUA 4DTRA 4L8RB 1RXIA 4FVMA 4CF8A 4ETIA 4RV5A 3E61A 1HNIA 3KLHA 1ZBIA 1YMUA 3OYBA 1D5WA 3M8PA 4RK1A 1PEYA 3GWGA 4IF4A 5IEBA 1RDCA 3BREA 4WXMA 3GT7A 4MLDA 2QR3A 3L2RA 3TR8A 1J54A 1SKWA 4GNRA 5IUJC 4MLCA 5F64A 1BA2A 3SQNA 2ATQA 3OY9A 3VQCA 4DG1A 4XFKA 1WSIA 1GLGA 2PY5A 3TAPA 3CFOA 4JASB 2G8HA 4FB4A 4UHKA 4CJ4A 4C8OA 3RVLA 4OPKA 1NATA 4YS6A 4CBVA 1U2QA 2LIVA 4IG0A 3QIRA 1IKVA 3AV9A 4CHZA 3EQZA 3C94A 1TKTA 1MVOA 1DZ3A 3HUTA 3GRCA 1RBVA 1A5WA 4JLHA 4BWMA 5IULC 5CYQA 3VQQA 4FW2A 3VQ8A 4G1QA 4MS4A 3F6CA 1VSLA 3ILHA 4ID1A 4H60A 2PUCA 1VSHA 1L3VA 5JNWA 4KTWA 4M3TA 4EUKA 4L85A 5SZTA 5IUKC 3RVOA 3W9SA 1CXQA 1EP4A 4G0MA 1K6YA 2GBPA 4DU4A 4RY9A 1U48A 4CEFA 4DFPA 1T34A 4RW4A 2OYQA 4LE0A 3MIZA 1FFGA 1BI4A 3V9UA 2PJUA 1RBTA 5JS2A 1X9SA 3QEMA 3ZSXA 3F7NA 2KTQA 1B00A 2L5DA 3NHMA 1TL1A 2HNZA 1XHEA 1HQUA 3V81A 2YKNA 4O4GA 3A3KA 3VQ4A 3V6DA 1ZBHA 1NXOA 2FMFA 1RT4A 3NCIA 1KVBA 4BDZA 1ZHHA 3JYTA 4S04A 1ZGGA 3L2WA 3MF4A 4DADA 3BBLA 4CGIA 5JNTA 4KQ9A 3N8IA 1JL1A 2O4IA 3LKBA 2HQBA 4YFUA 3LUDA 3R0JA 3RVMA 1TJYA 3I5AA 3O74A 4Y1CA 1XWLA 4FXDA 1JFVA 1RDDA 3SQ0A 1RBSA 2V0NA 4DTMA 4P98A 3EDCA 2HHSA 4NQRA 3OVNA 3CYMA 3VQDA 4FJ9A 3EODA 2DY4A 3QX8A 4LDZA 4E7JA 1DC7A 2IKSA 4ZHRA 3A10A 1EKEA 1SKRA 2BANA 4Q0BA 4N0PA 4DLGA 1D1PA 4WXEA 1LWEA 3ZSQA 4CHNA 4EVQA 2FBYA 3HO1A 1TL3A 3T38A 2RGYA 4FJKA 1Y1LA 2D5RA 1IKWA 1C0UA 3CG7A 4OGCA 3H5OA 3KTOA 4F3TA 1A5VA 2QVWA 3DLEA 4BE0A 3C6UA 3PX4A 3QELB 3F73A 1U4BA 4HHTA 4I9QA 3TABA 5EWLA 2VWKA 2PAFA 3GA5A 3NGYA 4I2PA 1ZBUA 2NUBA 2F96A 3NHGA 4F8RA 2I5JA 1TM2A 3AVCA 4CK1A 1Z18A 4NCAA 4ZMSA 3LMKA 5CNMA 3SUOA 3O1JC 1XI1A 3ZT0A 2MSWA 2XY5A 3TAMA 1MB3A 3JPWA 3OQOA 3CG0A 1J56A 1C6VA 4KHWA 4KK3A 3B6OA 3LP1A 1IG9A 4DFKA 5ED4A 3MEGA 3NF7A 3HJFA 3QEWA 5TPWB 4M3XA 3HXMA 4Z4FA 2VG6A 3O75A 1BISA 1CXUA 1JDNA 4OG2A 4G0PA 2IPNA 4ELTA 3H1EA 4PICA 4EYOA 4Q6BA 1NKBA 4FE4A 1KLMA 1QE1A 4KI4A 3ZCMA 1QSYA 2XY7A 4N47A 1MIHA 3LPTA 5C5CA 1ZITA 4RY8A 5FBHA 4B9NA 1PNRA 4DQPA 3LFTA 1FKOA 3CRNA 4KAZA 3C3KA 2Q3SA 4BE2A 4KPYA 5CHYA 2JBAB 3L6UA 1KSPA 3KYJB 4IBNA 5JNVA 2A9RA 4OLAA 2LSNA 4G0YA 3H6HA 3OO0A 4O0JA 3HS3A 5KQGA 3M8RA 3LKVA 3Q15C 5FWYA 4LRQA 2VYCA 4M3ZA 2YHAA 3VQAA 1RTIA 4KMRA 1ZAYA 3V9WA 3TAFA 3ROFA 3QLVC 4JB0A 4FZXC 5KC8A 3N6VA 4FK0A 3RVJA 2DRIA 3VQ9A 3Q7TA 2R25B 2GBZA 2IAJA 4DF8A 1CEYA 2G8WA 1FK9A 1R6ZA 3HV2A 2WJAA 3IP6A 1EETA 3EQ2A 5DLEA 3L2QA 5D3GA 3LUFA 3K5MA 1USKA 2G8IA 4OTZA 2OPSA 3OYIA 5HSGA 1T2RA 1JLEA 1R8JA 4RKQA 5HROA 3IDOA 4YRZA 3I09A 3IP9A 3LANA 2YNHA 1VSDA 1NJZA 1KFDA 4NCBA 1NXVA 1P6UA 4Z4EA 1T03A 3PY8A 2OZMA 4OKKA 2X78A 3TANA 4RS3A 4LE1A 2AYZA 4H8KA 1Q8IA 3H5VA 4WUTA 4RXMA 4H3KB 3ZSYA 4CEOA 3T3FA 2VUHB 3O21A 3H5IA 2W42A 1E6KA 1QS4A 3AVNA 3EYZA 4B3OA 3O2SB 4CF1A 3U3YA 2RN2A 4RXUA 4F12A 4NH5A 5B3JC 4PYRA 4RK0A 4JP1A 1U8TA 4MS4B 1NXPA 1C1BA 2RPIA 2A9PA 3SJJA 4C8MA 2FBTA 1B9DA 1SRRA 5JNUA 1P6QA 3OYHA 4D6XA 2WMYA 1FKPA 1JL2A 3OS1A 2MYNA 5KQLA 3OQMA 4CJUA 4CESA 3KD5E 1LWCA 1LK0A 3LDSA 5I3UA 3KJVA 3L8BA 2WJWA 4W5RA 1JXEA 2P4UA 1I39A 3QEMB 4HTUA 4DSJA 3A0UA 3S3NA 2A9QA 3SQ1A 2E4XA 3GV0A 1M5UA 3SCXA 5HP1A 1D9FA 3KLGA 3O3HA 4L4UA 4ETNA 4HUEA 2MYUA 1USIA 3DYAA 4DWIA 3HZHA 4MS1B 1NK0A 3I0RA 3DRRA 1IH7A 4DQIA 2O4GA 2PYJA 1A04A 2M1ZA 4DF4A 4EVSA 4QYMA 1BVHA 1NXXA 1CZ9A 4B8CA 2QW1A 2G8FA 4DFJA 4MQEA 3NHZA 4IDKA 2YV0X 1HPZA 4O1HA 8ABPA 3QESA 3RWUA 1SXGA 1HNVA 1VRTA 3SNKA 4DQQA 4IRXA 3F9KA 1A5XA 5DGCA 5ABPA 3N0WA 1J53A 2MYTA 3OLXA 3CS3A 3MJ0A 1ISSA 4AILC 4NICA 1UA0A 4MAAA 1UAXA 3PX0A 2FMKA 5FROA 4LSNA 5C24A 4FW1A 4YV7A 5J2NA 1A2OA 1QKKA 3RVKA 3URMA 1T2SA 2IC3A 2PKXA 1BDHA 4J2EA 1R4KA 3LOPA 3LUCA 1JX6A 2GUIA 4NH3A 3H5TA 4FJ5A 5BQ3A 3KJXA 1U47A 4KTQA 1ABEA 2IDOA 1GCAA 3ASMA 1WSHA 5TQ2B 1VLZA 2FLKA 3NAEA 3AO1A 4RXTA 3CHYA 3AVHA 3PO5A 1JFSA 4CIEA 4CEBA 2JBAA 1JYFA 3QLTA 1LW0A 1S1WA 4CGGA 4S05A 2QXFA 4JRPA 4FJMA 4KFBA 2E4YA 3KIOA 1NY5A 1DTQA 3LP0A 3QLUC 4TSXA 2Y1IA 1ZDMA 3M8QA 4KB0A 2XO7A 2HPHA 3BRSA 3V4IA 4RSMA 3SV3A 3H08A 3TI0A 2RJOA 2WB4A 2ZAYA 1QO0A 3FFWA 3LUJA 4LSLA 4P1ZA 1JLGA 4DTOA 3HSYA 1CHNA 4DTNA 1VSFA 4NGBA 2L19A 2FMHA 3CG4A 1W0HA 2L2QA 3Q9SA 3SUQA 3S3OA 2JGUA 4O1IA 4NGGA 1RTDA 3GBVA 3BDPA 4G0ZA 2HHXA 1LBIA 1RT5A 1Z2DA 5DKFA 1JL3A 1BL3A 3OJSA 3BILA 5FWXB 1EWKA 4KHSA 3EJWA 4CJ5A 1Z2EA 1BQNA 3ZSOA 1TKXA 1NK5A 3KTQA 3LAKA 3EZ5A 1XHFA 1VSMA 4CEEA 3O7XA 3ZSWA 1LAWA 2JVJA 5C25A 3K2PA 5CYMA 1WLJA 2JVKA 4JOQA 1S6PA 2JVIA 4E89A 4O0IA 3VA3A 2NZUG 3K5LA 2ZQBA 4O5AA 3WNEA 4E7KA 1WNSA 3FMVA 3EY1A 3OLWA 4Z4GA 3GYBA 4MS3B 3MXMA 3AA4A 3AO4A 3E3MA 2IPLA 2R7YA 2OA8A 1YTUA 2ZWMA 4CF2A 2ITGA 2FMIA 3SUPA 1U0SY 4LH4A 4PA1A 3MEDA 3ZT3A 4CEAA 5FRMA 2N9UA 3IG1A 2PUAA 1U2PA 4ELVA 4RWEA 4R5PA 2PUBA 5HRRA 4CHQA 3C6TA 1LWFA 2ZD1A 1ASUA 4O55A 2CWDA 2B5JA 2ID9A 4ICLA 3O3GA 3LPUA 1QTMA 2Q5CA 4LD0A 4M45A 1ZH2A 3VQBA 3NGIA 3Q7SA 1SKSA 1YTAA 4ZJPA 4YR7A 2GKGA 2LP4Y 5JNRA 3OQNA 3C97A 1BIUA 4WT7A 1RT7A 1L5ZA 4OGEA 1R0AA 3KKEA 5T7BA 3RVQA 1NKCA 2G8VA 3LP2A 1U49A 1NK9A 3AVJA 4AH9A 3HP6A 4CEDA 4IFVA 4H4MA 4FLWA 1M2FA 5HRPA 3TAQA 1KFSA 2WY2D 2P1JA 4MS1A 4OKEA 3TB6A 4KV8A 3UIQA 3VQPA 4IG3A 1VK0A 4MPTA 1HRHA 3OYCA 4KHYA 3A0RB 1F51E 4M3YA 4Z9BA 1EX4A 1W9HA 4UQGA 2PYLA 2FN8A 1DBWA 4HUFA 3KLEA 4NYNA 3S3MA 3OYNA 2JK1A 2QZJA 1C0MA 3I8DA 3DBIA 3KKSA 4DSKA 1X9WA 4LE2A 3DM2A 1B9FA 2IS3A 4FCYA 1DBQA 1JKHA 1WSFA 2H3HA 4E7PA 2QXYA 4FLZA 3GL9A 4Z4CA 3DOKA 2FLWA 1LJLA 4CGDA 2HHWA 4M88A 3ILYA 2FC0A 1GUBA 3GBPA 2GX6A 1QP0A 1NK7A 4PZ0A 4CGHA 5TQ2A 3QEVA 4WE1A 4CJQA 3CNBA 4OVLA 5K14A 1NK6A 2D0AA 2IOCA 3LZJA 4N5SA 3N53A 1C1AA 3SM9A 2PE5A 5JS1A 3OYDA 2VG5A 1DRKA 2X6SA 4JS4A 1BCMA 2QVCA 3VN5A 2XHBA 3RRHA 4KK4A 4FJJA 2AYXA 5IBQA 3QO9A 1KGSA 1S9EA 3CFPA 3BRQA 4TMYA 1A0OA 2YHBA 3UUGA 2WWVD 1QNLA 3TARA 3OM1A 3O3IX 3L3VA 1XC9A 3KKRA 2HNDA 1APBA 4RK7A 2HQOA 1UA1A 4PUOA 3JSMA 3FDFA 2P5GA 3HUUA 2HHTA 1RDBA 2VK2A 4RDCA 3O1IC 1FFSA 5CNKA 3QINA 3CKMA 3ULDA 2DFFA 4KZKA 3K5NA 4CCHA 3TWHA 2XRIA 4KREA 4XAQA 2CHFA 4MR8B 3AA3A 4IFYA 1WSEA 1DBPA 1U04A 3VNAA 4W5QA 1SL0A 4Z4HA 5J2QA 4PEVA 5E3JA 4OKJA 4CK3A 1QSLA 3QELA 1CLQA 4B08A 4DTSA 4B9TA 3C3WA 3SG0A 4I7FA 4Z0NA 2X6NA 5KTQA 3AO2A 3EGCA 4HNQA 2ZE2A 3HPOA 2GI4A 4QYWA 4YO7A 3QLHA 3SI6A 1C4WA 4F06A 4K8ZA 3O4QA 3Q41A 4J2AA 5EWJB 5TPZA 1Q9YA 4B9VA 3OYKA 1NOZA 3TAGA 4YGXB 4CFBA 4N41A 1FQWA 1LBHA 4N03A 3AA5X 4N56A 3NH1A 2PUGA 5C5EA 4DFMA 1NK8A 3LUKA 4AHUA 3OLVA 1M5TA 2MYPA 1BDIA 1EAYA 1VSEA 4ZTJA 1RTJA 4EP5A 5HM6A 1KRXA 3RR8A 1ASVA 4NGFA 3NH0A 3RRGA 2HW3A 1EHCA 2PL1A 5CNJA 3K59A 2MSLA 4TLLB 1I3CA 3C3MA 2KFZA 3D45A 2RJNA 4JB2A 1DCKA 4XARA 4RW9A 4CECA 3UKJA 1LAVA 4LDAA 4J2DA 2KFNA 2CD7A 2Z1HA 2WONA 1JLCA 1GOBA 3I45A 1BDJA 4CJWA 3LALA 1DCMA 1AB6A 4FZZA 4H3HB 1DJMA 2FFLA 4Z4IA 4K8XA 2R47A 4E7OA 3AVMA 2QU7A 5DTEA 3TX6A 3AVKA 3P1GA 3KLIA 3NNSA 4FZYA 1GUDA 5GQSA 1I3AA 3LP3A 3OYLA 1RXEA 4DSLA 4M41A 1E6MA 1X1PA 4TN5A 4HVJA 3NNNA 3H5LA 3SAJA 1QSSA 1YK0A 2Z1GA 1D2AA 2HVHA 1KRPA 4O44A 4DS4A 1L5YA 1EFAA 4MR8A 5CY4A 4C8NA 2BGGA 4F2RA 4BE1A 1TKDA
chains in the Genus database with same CATH superfamily
2QVZX 1JPVA 1WCYA 4UAGA 3B6KA 2WK1A 3FCSB 3HZ6A 1J00A 3GA7A 1PR6A 1NVFA 1NNSA 4K25A 2HC9A 3PC3A 1OXXK 2XVZA 3DP9A 4UU1A 3N7TA 2YJ5A 3RFTA 9ATCA 1EUYA 1XCPA 4FD2A 4ZU6X 1WTAA 3A28A 1IUKA 3IE2A 2FSSA 2OVFA 2Z5GA 4NG5A 5CB4B 1Y1QA 1X1SA 2J7PA 3UK2A 3NHWA 1JHYA 1KYXA 4YDHB 4N5MA 5E38A 4M1YA 5KO2A 2A33A 2Q1YA 2EP8A 3SEZA 3CVWA 3G1TA 3U31A 3ROKA 4XOUA 3TD9A 3UWSA 1Z2OX 3PQ3A 1S3FA 2WILA 1Q3HA 3AVBA 3LI2A 4QGGA 5BV8A 2CGKA 5CFRA 1N3LA 4ESVA 4UM9B 2Q9UA 3UKRA 1YL6A 1P2FA 2DWCA 3LIIA 1SI3A 3NAQA 3OCUA 3EQ6A 3BKXA 1VBMA 3PNVA 4HNAA 4TMFA 1JLBA 1RVV1 5DOZA 4PVDA 5FYQA 2RHKA 4QSHA 2F6RA 2Q5OA 5C8YF 4OGFA 3U3KA 1EJ2A 1Z25A 1YB7A 4IYJA 5IJ0B 1P3DA 1CF2O 2I4RA 1HFJA 3A9UA 3B13B 3DE4X 3V4ZA 5KNCH 3ZI4A 1JWLA 4KHPK 3IERA 2Q1NA 4FI3C 3T34A 3VDQA 1HE5A 5E3HA 2Y0CA 3CFYA 3D81A 4QOHA 1XLTC 2V54A 2JRLA 4O4IF 3ZKAA 4OMDA 4XQCA 2E1RA 1PR4A 3I9FA 2HBLA 1FYDA 4OYHA 4ZYTA 1SL1A 1YITN 4OYRA 1VIYA 1OFIA 4MROA 4B6OA 4Q3KA 3VEYA 2FZEA 1JIJA 3S8MA 3K0SA 2MR5A 3SBDA 3MELA 1XFDA 3TXYA 2OHGA 3KOXA 3WLLA 1UBOS 3BDVA 1TMKA 1CB0A 1G5RA 3QEIA 4E11A 3DMDA 1SNYA 3P20A 4OFZA 4AZTA 3DPIA 5EKSA 5BSWA 5JADA 5AIBA 2X9QA 2YVQA 4JR2A 2EEZA 2QMZA 4NENA 4R31A 5KKAA 1I2MA 4M89A 5CCEA 5K03A 3PXUA 4C0QC 1UC4B 3E58A 1OYVA 4ASUD 2PTHA 4GMDA 2H57A 3HYRA 2KMLA 1J2EA 1HYZA 3IMFA 1ZD1A 5JPIA 1EWVA 2H5JA 2NPIA 1KYZA 4G9GA 5CZ2A 3H2KA 5DGTA 2FUG1 5LDGA 1BROA 2NGRA 4H0XB 3ICCA 1QC5B 5DCUA 4YCMA 1NKVA 1CZUA 3VQ7A 2Q1XA 1GRQA 4FLYA 1DIGA 4ER7A 2ECOA 1QAMA 1X3NA 3AVGA 1AS0A 1FXSA 2HJ9A 2ICAA 3QP9A 3VKWA 2QIOA 1CX9B 5D87A 4HLUA 3RW9A 1JAZA 3V1MA 3LL4A 1L3SA 2IHKA 1T5HX 2YCBA 1UMKA 4LQ4A 5IZ4A 5KQRA 3E27A 5KVVA 1KE2A 2NUTA 5FUMA 1EI9A 4Q3CA 4Y2RA 2FWJA 4L15A 2QW9A 1N5OX 4DJAA 4QXOA 4G67A 5ICEA 1YCHA 3SWWA 5JQWA 4KI7A 2EBWA 1O7JA 4ZTBA 2F4NA 5GONA 2PD4A 3ECCA 4DLEA 2QMEA 3E82A 5H3HA 3MZ0A 5EQFA 2ZM6B 3Q7IA 2R00A 5KTPA 1I7NA 2UUPA 1FUUA 1UH5A 1MCZA 2HNKA 2OBBA 2VJKA 1IM5A 1BHQ1 1N0VC 1XEXB 2CLOB 2I78A 2RH9B 3KLNA 1EWTA 4YJGA 4BNDB 3AAQA 1DNPA 2C3PA 4GLFA 3RR2A 1U2DA 2B5WA 3QUBA 4ZU3A 1P18A 3VPHA 4X66B 3NYRA 3MTDA 3CZQA 1ICIA 2OWEA 1EE1A 4DPKA 1PS8A 3FNGA 4PLPA 2BFMA 3R3VA 2I7VA 4E0DA 3R44A 1E6WA 5B57C 4QGAA 3VA7A 2P7HA 3MPOA 5LQUA 1VHLA 3ZDBA 1T6YA 3NNDA 3C4QA 1S1VA 5SY6A 3K9LA 4BVPA 1VJDA 3DVLA 3VAAA 1C2YA 1ZM3A 3CNHA 3OLQA 4PPFA 4WJZA 4MYRA 3BERA 4KW7A 2YJ3A 4N0DA 4CR6A 3EO3A 4RJLA 2GVNA 3GFPA 3T5DA 2RGAA 5KJ6A 1FRZA 2V3WA 4HLDA 5M04A 1BCRA 4JXXA 4C4RA 3UIEA 2NSYA 3O3CA 3W05A 1U1IA 1FW6A 4L72A 4KI6A 2J4FA 3PNMA 1BIZA 1VECA 2FVYA 4O3MA 2HDNB 3DUFB 5EJ5A 3GU3A 3MYYA 3OIWA 4Y98A 1S9GA 5KU7A 2Y27A 2ZRCA 4D0RA 1D0VA 2OAQ1 5KPRA 2X0RA 3C16C 1NP3A 2VJOA 2PJDA 4EFHA 2IKQA 4FMPA 4PS1A 3BGOS 1H1TA 1M6VB 1RDFA 1EFHA 3MBKA 3WHLA 3WZLA 5I7OA 3N6XA 4XASA 3KAKA 3U9SA 3IXMA 1NMSA 3A8YA 3V8RA 2D0DA 3E66A 1DC4A 1V5EA 3PQ6A 4TV9B 3H3JA 4DG5A 1I4OA 4PIVA 2MSNA 4DXDA 4EYQA 4ZT2A 4U8GA 1FRQA 4TTTS 1ILWA 1E79A 2V9ZA 4Q82A 2G5CA 1PK7A 4N40A 4E7IA 2FZWA 5IF3A 1QTRA 4ARIA 3P5JA 4NZMA 4WK0B 3ZE7A 4UUNA 5JNLA 2KE5A 3PUHA 3EDQA 1SM4A 1F2VA 3FJ1A 3JAKA 4K6OA 1IBKB 3DDNA 2HPZA 2QLTA 2EJCA 2FWBA 4Y9DA 3FG9A 1AKUA 2H2IA 4U2KA 4DV6K 5EIHA 3GFTA 5KWEA 1O5IA 2OENG 2VAXA 1DARA 3CE6A 4N12A 1USGA 3NRJA 4WDRA 1RQ2A 3LKZA 2BTEA 4TLEA 3GLGE 1YNOA 4TSFA 3ZDAA 2BPOA 1TLFA 2GV9A 3ODGA 5AT1A 2P3SA 1ZZGA 5ENZA 2WJ3A 4C7KA 4YIHA 3BXGA 1HLDA 1YQEA 1OBOA 4MR9A 3MN7A 3IFRA 4US1R 3DOIA 4BRDA 1FFBA 3UHOA 4EYGA 4NB4A 3FTFA 4QX6A 1XKXA 2ECQA 2JGEA 3TL3A 3EMVA 2ZG6A 4GXQA 4HDRB 4IIJA 5AICA 2YV5A 3ZDZB 4ZI7B 4FJ0A 4KYVA 4EKEA 1QTQA 3E48A 3HB0A 1QV9A 1RM5A 3T19A 1NVXQ 2CBZA 1YWGO 3IV9A 2Q8NA 3Q6NA 1UDWA 5F3DA 4GOLD 5B7QA 2GRAA 1KPHA 1HRDA 2JIOA 1J7JA 4RZSA 1H5UA 3EVCA 2KZMA 3GD7A 1L4EA 2OFXA 4H1HA 4E13A 4JQSA 1W5FA 3EFEA 1J2YA 3JYNA 1ZN7A 1H6DA 4BQLA 5LQJA 2BTQB 3FZQA 5A6VA 4Y6RA 4BEJA 5HX7A 3VKHA 3RJMA 1E8DA 1U5BB 4N1AA 4FWRA 3ZBUA 2P2YA 2A4KA 5CW1A 2AA4A 4LXYA 4W5TA 3R2JA 4PG8A 3MVEA 2JA2A 3A8TA 4C6TB 2PZSA 1SGWA 3BFXA 4NOLA 1XTUA 2RKWA 1FMTA 1ZU4A 1JHQA 3D6HA 3GCWA 1XMQK 1TD9A 3P2EA 1IWPB 2QTLA 5CB4A 4CKCB 1JFTA 4GKJB 1QH9A 1I4LD 2QLLA 2WZDA 2OC4A 4MQFA 4M86A 1TJ3A 1M7HA 3RMDA 2XB8A 4H4OA 4CF9A 1LC0A 1XZNA 4HXFB 4C20A 5CGZA 1OH8A 1K6JA 1YZLA 2IVFA 2XNSA 1X7ZB 4ZEWA 3SZ3A 3K2IA 1CUEA 5B3KA 1O4WA 2GA8A 2J48A 4O4IA 4A4DA 3LUGA 2FXIA 4MEJA 5ALLA 4D92A 4DN6A 5TPWA 1UPBA 1P39A 4RG8A 4P0TA 4RGQA 3PTAA 3H5WA 3U17A 4PF1A 4WEQA 3RWMB 1DTWB 2VZ9A 5DT9A 3EVDA 3IRUA 4NBLA 3VSDA 2XUKA 3STYA 5HS6A 2OFPA 4W9NC 1YUNA 4E30A 5KKNB 5F9HA 1FCJA 4KHQA 4GNKA 4AXBA 3SBEA 4PKHA 4PR3A 4CKEB 2XZLA 2A5XA 4I2NA 3AL0C 2W2KB 1D2RA 2IT1A 4GR4A 2M6KA 3UA3A 3OJEA 3H9BA 5AW3A 1IIBA 1Q1EA 3KUCA 1V5FA 3I2FA 4Q1FA 2PM8A 3O9SA 2BEWA 4KC0A 4MPJA 4OXYA 4I08A 1GZDA 2G4VA 2WDZA 3IPYA 4FDTA 4UD6A 2VPPA 3QZUA 3ESYA 1Z7WA 3C6YA 4G97A 4ZO6A 4A9AA 5KYTA 4IZIA 2RONA 2QUJA 1WEKA 1LV7A 2IE8A 2J9XB 1FW8A 2WHYA 2W2LD 3JZFA 1JNXX 4LC1A 3ATVA 3VQEA 4OREX 5EXPA 2O7RA 2Q2QA 3IIIA 3LHKA 1AC5A 2XW6A 4MMZB 1D6MA 2CK3D 3F6PA 3DTYA 2A40A 2R68A 3DF7A 2JIQA 2DULA 3UJ7A 5J2MA 2QSJA 1B43A 1R0YA 1VP9A 4PHTA 2AE2A 1U6ZA 2GM5A 4ITVA 4TKUB 4C3UA 4C4AA 4D5GA 3AWDA 2JHPA 3HA7A 4PLCA 3AARA 5AQQA 1G19A 4QATA 4B6QA 4DLKA 2DTUA 4AUMA 3LYUA 3P9YA 1U2GC 5ESWA 4BP3A 4KPFC 1QIGA 3UGTA 5JO0A 2P6RA 2EW2A 3NUGA 2D3WA 4A8PA 4NSNA 4DCNA 2QM7A 4TOIA 1MTZA 4BO8A 2V1XA 1ULZA 3VO2A 1WXWA 3G6EN 5IFLA 2V4ZA 2CC2A 1UDRA 4DSUA 3P4YA 2JHGA 2WFLB 3BKWA 3NBKA 4JJEA 2PBLA 5K4HA 2I9KA 2F59A 1QCDA 5DEIA 2F1HA 3CYFA 1TK3A 3DAPA 4BYMA 3PT5A 2OPRA 4RAQA 4BX9A 3WHKA 3CIOA 2FPUA 2EGGA 4PQEA 3SGLA 5KQPA 3KZBA 1N7GA 1QAOA 3BGSA 2HJSA 2XCQA 3EVZA 4FYMA 3LBNA 4LBZA 2W2OA 4OLJA 1MEOA 4QU0A 3SJHA 1TZCA 3FE2A 3DLRA 3ND5A 5EJGA 5F7XA 1T2NA 2OMKA 3DKKA 2EKPA 3PQCA 1MX1A 3O84A 3UMRA 2Y99A 3SZRA 3V8VA 4DU3A 1THMA 3L1VA 2BFPA 4NJOA 3R7FA 4BMZA 3HEAA 3HKDA 4DLBA 5CMLA 1DRJA 2C96A 4H1WA 3U4LA 3LUBA 3A5LC 3IDSA 2BBOA 2KQUA 2LZ0A 1XXHE 1SVWA 4QQRA 2GS9A 1OJ7A 4X62B 2HF2A 4YMGA 1NLMA 2KQ2A 2OCPA 2XRYA 1B8OA 1KYTA 3QWFA 4H7EA 3S0JA 3TAHA 2X6TA 1WLSA 2O2JA 2P65A 2P9JA 4BO7A 2CT8A 2ZBQA 2EBHX 2ZUFA 3ILSA 3QY0A 1M1KO 3GLSA 5DK5A 2X9VA 2Q5FA 3EXEA 1CZBA 4FJIA 3Q98A 4YXFA 1VQLN 2HM7A 2J6CA 3EUAA 1FNMA 4BBAA 3KHUA 1TK2A 4GZMA 2AVDA 3IT1A 4HXYA 1RKXA 2EFDB 5T8KC 1U2RA 2YWHA 3NBUA 3BF1A 1PZEA 4HATA 1D4ZA 5FBQB 3FYUB 1E2JA 2G17A 4ISGA 1E6LA 1QVWA 2QX6A 4JAXA 2HVIA 2XFMA 2V4MA 2IHZA 3L6BA 1BDGA 1QHNA 4JX8A 1ZYQA 3I0SA 1WPGA 2ORVA 3UXHA 4R9NA 3AUAA 1U7DA 3W8NA 2CNNA 4G2TA 1ZBLA 1RNHA 3ABIA 1RT2A 4R3UC 3ZCPA 3GLHA 4ZCMA 3HY6A 3IT2A 3WGZA 4B6PA 2H7YA 2C8JA 4YMSA 4XLZA 1PKEA 2Q7DA 1XXHA 3GWZA 2UV8A 1QO0D 1VGQA 2Q2OA 5DN6A 4AYWA 4E5KA 3D0QA 3QE2A 3QX9A 3IS9A 5CDSA 1ESVA 4EG3A 2HCFA 2NACA 1RBYA 4TUYB 4F11A 3O5AA 3SAGA 1I14A 3A4NA 4IJQA 3SMSA 4Q7QA 4Y0WA 2QHXA 3HNRA 3R6TA 5BSTA 5LSAA 1XFAA 5FWNA 2XT9A 3SN6A 4EFLA 3QPCA 1X80A 4XQ9A 1MU0A 3CJ1A 1FU4A 1TAUA 1RLUA 1USUA 1UWVA 2EJWA 3IELA 1N2GA 4Q6WA 3CLUC 4U7TB 4MHOA 1ZLXA 5A4AA 4S1VA 3FGOA 3QRWA 1BHJA 4M87A 5LM3A 4D79A 1L1FA 1KJ9A 2J85A 1FB5A 1R27A 2ID4A 4KWHA 2A30A 2ABWA 2GH1A 3V1NA 5K2OA 1I10A 4CVNA 2TS1A 1VJGA 2OGTA 3E3OA 2G70A 4MVJE 5AMXA 3T7AA 3VR4A 3ZTTA 3K57A 1UFKA 2QP3A 3M6GA 3DPSA 1VMIA 4LX8A 2B21A 2I1LA 4HYQA 4Q48A 4CT0A 1BE0A 1PR2A 3GY0A 3GLHE 5DHTA 4IRMA 2HQRA 4B4UA 3ZYYX 4JSYA 4Z7QB 1PDOA 2NT3A 3IKVA 1S4MA 1CP2A 1LWNA 2C2HA 2O6LA 4G1CA 4GDFA 4KR6A 2Q0SA 2P9IB 4YUZA 3KKKA 4QBTA 3BXHA 4ZXFA 3EWIA 4OD0A 5JCOC 1T2UA 3T3MB 3KAJA 2O9JA 3EXIA 5GOZA 3U09A 1SB8A 3AVUA 4FLTA 4BDSA 3SOPA 3VZPA 5A2QO 1P9WA 4DQRA 2VDWA 3F6BX 3GPCA 3HCWA 3KWJA 4M54A 4M9QA 3VHXB 5FBVB 1IK6A 3OOWA 4W5JA 5KWSA 1BN6A 1ODIA 1KE1A 2NX2A 1YVNA 1M3SA 3S28A 4CUZA 3DLTA 1V3VA 3FLBA 4RW0A 3ZOKA 3Q2KA 3M8KA 4XTCS 1TVMA 4MR7B 5EXXA 1HDZA 5FI5A 3WTCA 1JDUA 3KSBC 3VMFB 5HLFA 1VJRA 2RH8A 4PZPA 4IMIB 1K66A 2H7XA 3PGA1 1DO0A 3T95A 5K3EA 4Z94A 2JAXA 3T8YA 2B8WA 1OBHA 4HNSA 4PFJA 4RE6A 4ZAFA 3NHBA 3WLMA 4B09A 4E1MA 5EIBC 4ZKEA 3VQ5A 5I01A 1ZJYA 3WBJA 3U7EB 5I6DA 2EL7A 1ZBFA 1UJBA 1PWEA 1B14A 2ZVPX 3AY6A 1CUFA 4RQUA 2FEKA 4AUEA 5HW0A 5JWRA 1HQEA 5C0OE 3L4JA 2Y2VA 4F4KA 1OF1A 3VYTB 5DCWA 3RV3A 3CUEF 1SULA 4EPYA 1Q1GA 2ETJA 3HUEA 2NXEA 3KWMA 4ACAA 4BFVA 2A9OA 5BREA 3D9QX 3IP8A 3JWJA 1Q22A 5E1DA 2YR0A 3DTNA 3AUTA 3A4LA 3LBHA 3WL5A 1DOHA 3GRZA 1D4XA 3RTVA 1AVTA 4QG3A 2J0SA 1WN7A 1YI2N 2VEOA 1EXDA 2V7XA 5DTJA 3RIXA 2WJIA 3P32A 3RVNA 2V51B 5K0BA 1HT2E 4QQKA 3MNFA 5CE3A 2GD1O 5EJ6A 2JGFA 1N6PA 2V7WA 3VC7A 2QN1A 3T5PA 1DAIA 1KMIY 2L17A 2P1DA 4R9VA 5HF6A 3VPGA 3VENA 1Q3TA 3UHJA 2HCTA 4MVJD 5BOSB 8ATCA 4BROA 1M8JA 3SE7A 4LXUA 4XJSA 2AJQA 4DR2K 5CVDA 1ICEA 4TL6A 3U37A 1N2ZA 2H17A 3OU2A 5CNIA 3CUKA 1NBOA 3DL4A 1U1EA 1NP7A 4EH1A 1EJ6A 2QLBA 3HUFA 3NG1A 2XB9A 2QRZA 3A4MA 1CDZA 2JFVA 2VYNA 3NIDB 1CE8B 1G41A 5C42A 2XTNA 4MRSA 4D4HA 4CEIA 3GDFA 4IFIA 1SIBE 4JI0B 4HDRA 3QBDA 1BQEA 4KQCA 1VYNA 2VJBA 4FHGA 5H68A 3T9EA 4CM4B 1RXVA 3TNYA 5JI3E 5DFAA 1IIRA 3PENA 5JU6A 3HZZA 2HLPA 3O9QA 3HSSA 3GE1A 4NULA 4MGYR 4G0XA 1NNUA 3ZT4A 1ZNYA 1E32A 1XJWA 2CHUA 1Z4MA 2GCOB 3KK7A 1I6KA 1WDTA 2QV0A 3HA3A 4L3WA 4QBFA 1HDEA 5DSZA 2PUTA 4DT1A 4HB3A 1X13A 1PNOA 1O9HA 3VOBA 3VM6A 3RMCA 4BP1A 4CFYA 1W0KA 3IUJA 1I7QB 4L5YA 4ZVNA 1KRWA 2FEAA 1MORA 3JQDA 3NHJA 1G0OA 1ADGA 4G3XA 4JA2A 5CVJA 3DYVA 3OCYA 3JQ8A 5IKPA 3G0ZA 2G82A 3B6PA 1FDSA 2ZBRA 4GVXA 1DQRA 1G3IA 3OZUA 3A37A 5K0EA 4ID3A 4EHBA 1JWBB 1IJFA 2NZ2A 2Q2VA 4DV5K 1TLLA 2B0JA 3MUOA 3R6LA 1YUBA 4NOKA 1RWOA 2EFCB 2P9SA 2OZLB 2WF8A 3AR8A 4ZU1X 4JQZA 4MJLA 1U2DC 1UXJA 4IOMA 4FWTA 2Z6VA 1XZLA 3ZXUB 3PZBA 3EY4A 3K4QA 3ZHRA 4NMMA 4UEJA 3KB1A 3M6VA 5IF9A 5GZ3A 3RYCB 5C51B 3QETA 1F0YA 1ID1A 2JFBA 4XQ0A 1C80A 2DR3A 2ZAIA 2GUPA 1JGTA 1GPAA 1VG1A 1C29B 2F9MA 5JYDA 1YVPA 3WGKA 2OK8A 3DEYX 5A4DA 1XN1A 1QVRA 4RKWA 4UTRA 5DCLA 4JQYA 3TSAA 3I3SR 2KZZA 3LV8A 3MTAA 1ZVJA 3WJAA 3G79A 3VU8A 4TVSA 4XDGA 5P21A 3I8XA 3RGWS 3OQPA 4EVRA 1JIUA 4J4TA 5DRYA 4FX5A 3WL7A 4NS1A 1NF2A 1WMBA 1X1RA 2WJVA 3OCJA 3HHEA 4MO9A 2WM2A 3LWDA 4QUEA 3WNGA 4N3BA 1Y33E 3D6NB 3FPJA 4WN3A 2XCTB 3ICQB 1IO2A 4KH6A 3BSWA 3VR6D 3ZT1A 1QJCA 4RVHA 4AP9A 4IFBA 3CXCM 1OFGA 3AGPA 3ZYZA 3BXZA 1P0FA 2YXDA 1PGPA 4BLQA 5BPNA 4JI5B 3SPYA 2Q0QA 2FPPB 2WUDA 1DQZA 3PXEA 4UHHA 3U9DA 2WIAA 1QHYA 1YBFA 2RI6A 3EXFB 5IN5A 3TLMA 2I7CA 4M4SA 5FI0B 1M75A 4IHAA 3CM6A 3FIJA 2VGMA 3QVGB 1XHXA 5IT9A 2ZAGA 4OJRA 4MX8A 2Y1EA 2O2GA 2YC2C 3CISA 2OB1A 3M83A 4IZHA 5HKLA 4EY7A 3K0AB 1JEJA 3WYDA 3FPAA 4O8KA 1EXQA 1ZM4A 2AWOA 1MOQA 1SD5A 4ZVPA 4FWPA 1K6IA 2AUTA 2IIQA 2B4RO 3SHWA 4CU2A 5IS2A 3AL3A 3SR0A 3LM2A 3PIOL 4YYEA 2H48A 3VNQA 4KU4A 4XYBA 1TT5B 3O9RA 4URZR 1DV2A 2B6AA 1PNQA 2I2DA 4FOTA 2ZSHA 1SV5A 4GMGA 1T05A 5JAZA 1OVMA 5LQDA 2C3MA 4Q05A 2BDTA 3SYNA 4RSGA 2NV0A 4G36A 3QKIA 4DV2B 4AHTA 3OYAA 1LQUA 1YQWA 2H2HA 2ID7A 2ZR8A 2WOMA 1KI3A 1PJAA 1E1DA 2CW5A 3DKIA 2GUWA 3ISTA 3OTHA 4YC7A 2WABA 4OIMA 3FM9A 3NR2A 5EA2A 1N2JA 1GU1A 1UC8A 3GH1A 3C3CA 1DC8A 4KLNA 3BMNB 3HY3A 4MKRA 4HDKB 4QS9A 2F8TA 1Z0FA 3DT6A 1W2WB 3AVXA 2NSHA 4TTIA 3MWEA 2OO3A 2I87A 4EUEA 3AESA 1TM1E 3R3XA 4R1SA 4IMJB 3BEOA 4I4IA 2Q6OA 2CFCA 3PDIA 4N0QA 3CPHA 4R0NA 3ADKA 1P5JA 4W7IA 3M5RA 3L7DA 4XUEA 5F5XA 3WMRA 1COWD 3DLBA 3BUSA 2J0QA 1XU9A 2CLLB 2Q46A 5DM2A 3AI2A 2CXSA 4TV8A 2AX3A 4G1EB 3DA5A 3NWEA 2RKBA 4L4RA 4RPIA 4XYMA 5DXFA 1KZGB 3I76A 2RFLA 5AVSA 2H59A 1F4LA 1W4BA 2JS7A 2QENA 3CLTD 2DY0A 4UZSA 1L3UA 4MGEA 5IYZF 2VHCA 2EERA 4BGEA 4W99A 4I2QA 1XZ8A 4TXHA 3KDPA 3NCHA 1Q0HA 2ACEA 3KG2A 2QRMA 4GX0A 2ANBA 1I9CA 2GR9A 2H54A 3D2BA 4Q47A 4JGIA 3RC9A 3UWDA 1XR3A 3AY3A 1V16B 3P7MA 3B2NA 1KP2A 3GQBA 4WZBE 3EISA 3BHNA 4JEIA 3ZHSA 1ZESA 3D0KA 5C52B 1E60A 1Y4DE 5GONB 2B4AA 2P4QA 2J6BA 3O2QB 4IOLA 4BGAA 1AB5A 1ABFA 5TPZD 3X2SA 4FYYA 1RW4A 4OK3A 4BQOA 1IPFA 2PD3A 1Z17A 2YNMC 4C0BA 5CYPA 4CL0A 1ETUA 1ZH0A 3OTOK 1A95A 4TMWA 5EVJA 4AHRA 4I55B 5KJFA 1BQMA 1FQJA 1NUPA 1LQ2A 2AG0A 1Z4LA 1JQJC 3F5SA 2XMRA 3H1AA 8GPBA 3QW4B 4XW2A 5EP2A 3WNQA 2AJDA 3AI3A 1QGDA 2LXNA 3GVXA 2A0XA 3KUDA 4PC2A 2GETA 1NK4A 4XYEA 3Q1KA 4FEEA 4AG3A 2WTNA 5JCXA 5CXQA 1DEHA 3IV7A 4C0JA 3MWDA 1SVMA 1I4TD 2J9FA 2GCNA 3G5LA 3ZD7A 1V1JA 1FIUA 4RIEA 3QICA 1FX0A 2G9RA 1MOPA 2JCXA 1LPPA 4J1NA 3FGUA 1JSCA 1OXBB 1WVIA 3BA6A 2VSFA 3TQFA 5FX2A 1U3UA 1XTTA 3I9V1 3CLRC 1E2IA 1BFKA 4DMLA 1JSRA 3A5OC 2F1JA 3LIPA 4IYRA 1MQSA 4X1KB 1PQPA 1I4EB 1TXGA 1FVXA 3QKUA 4S1TA 1PUJA 2WJYA 2YZKA 3R6MA 3DBHB 3OTWA 3PUWA 2JFYA 4XWOA 3EUWA 4YI3A 1BMQA 1H94A 1OFVA 3MAQA 4TLAA 4DRXA 3BRCA 2CFTA 2CHEA 3UTCA 5DTQA 4MQEB 4XLLA 3FVTA 3PXBA 5CDFE 3CZCA 4F46A 5JH7B 3GFBA 3A6FA 4ZWNA 2A14A 3B7GA 1NTRA 3B48A 3MOSA 2CMHA 1TYQA 4CHYA 4KX3A 4TVBA 3UMJA 4D9EA 4DQDA 2HWUA 4XOIA 1IAVA 3ZVRA 1RI5A 3GFRA 1NBWB 3EXG2 4XJVA 2ERCA 2H7CA 3SX4A 3PKZA 3ONWA 1UWBA 1UMDB 4JZYA 4YUAA 1FSFA 4HCJA 3M1FA 3L4SO 4XUCA 2R7AA 2VK4A 2AUNA 4CF7A 3NGZA 2X1LA 4NMWA 5NLLA 3VQ6A 5BW5A 5F2NA 2YRWA 5DTIA 3BMCA 3BL8A 2VJDA 3FW1A 1QTNA 1R6AA 1R6VA 3AJAA 3BTSA 1VBKA 3H75A 4FNMA 1RBUA 4GR9A 4MGIR 4MPPA 4RTOA 1CUUA 1JTEA 1VA4A 1VPLA 4I50A 5I7SA 1HLUA 1W97L 2FN4A 4QDXA 5L6MB 2O0JA 3DVRX 2WTEA 2JAUA 4ZYZA 2MHCA 2POCA 3O6WA 3HXPA 3Q88A 3T6KA 2R1UA 4DTJA 5DBFA 3TLZA 4JYAK 4H77A 2GNAA 1YI8A 4IBOA 2FMUA 2HSGA 2VG7A 3G2MA 4V2UA 5LXTF 2QV7A 3IQHX 5DBGA 3WXLA 2REXB 4GRDA 2HXYA 3T54A 2D62A 1K1EA 3HFSA 4RTPA 3CX3A 1REQB 3H4IA 3OHSX 3RKRA 3QB0A 7ADHA 5ILQA 2PRSA 4OQQA 5IJ0A 3VVLA 1DPGA 3MCZA 3RROA 4AO7A 2A41A 3GLIB 1O08A 5KC9A 1AZTA 1VSVA 3ETGA 3C3YA 3LGSA 4FJXA 4QPDA 5KTMA 2O5EA 2GLTA 3DP7A 3NH6A 5A71A 5KJCA 2VJQA 3SV4A 1ZK4A 1FXXA 4JK9A 4AD8A 2QUZA 2CUNA 3FA2A 2QTGA 3GARA 1RIIA 2I03A 1YZKA 4U5XA 2E4VA 4WZAA 2FP3A 3FHLA 4U02A 4WXRA 1Y9EA 2BEKA 2GRJA 3FLAA 1B8UA 4R2IA 3WLTA 5IUNC 2Z83A 1L5FA 5JVDB 4UTPA 2VBFA 5JAOA 3BDIA 4JVNA 3ELYA 5SYAA 3RRZA 4AQDA 5C5DA 2TYSB 1BXRA 2C1ZA 3RU3A 4HAYA 4CDNA 1YT3A 3ZUGA 3DVSX 1H9BA 3TEJA 3V55A 3V9PA 3RR7A 4PBRA 1QC5A 3KXKA 1PWHA 4IUDS 2HZ7A 3PEUA 2GWRA 1B0PA 2VZEA 3AHJA 1YE8A 2GVZC 3KZVA 4MLZA 3E5RA 2Y0EA 2POQX 3IAS1 1J4AA 5AI8A 1QQAA 3JD4A 1J99A 3GGCA 3QWIA 1YA4A 5E2AA 1DKNA 1TB4A 4ODIA 4CEIB 4R7ZA 3ONEA 4Z8YA 4DV3B 4FYDA 3JZDA 4W7HA 2OG1A 3K8QA 1NJWA 1U8UA 2RGBA 2WU4A 1Z56C 3BIJA 5E7IA 2A5DA 4JS0A 4ZVVA 5L9AA 5I7UA 4KR0A 3O8CA 2VF2A 3UB3A 1HOXA 3A6JA 5AWFC 4A10A 4BAGA 5L3QB 1EHYA 1P5FA 1U2SA 2VNAA 2J3HA 4HEHA 3ROQA 2FVXA 2VHYA 1NJXA 3O1HB 1XOIA 2E2PA 2E4ZA 2X5OA 3R40A 4MS3A 1B92A 5D5PA 5JTUA 3QPAA 1ISIA 4DB4A 1WETA 4UCQA 2YMLA 3SMPA 4FEGA 4NPCA 1YFZA 1G9XA 5AI5A 2WJ4A 1XB2A 3AI1A 1T44A 2C3YA 3RV4A 1R4ZA 1GFIA 4M3UA 1DPFA 1HE8B 3QBWA 3LS2A 3LWNA 3QXCA 3PFIA 1LTQA 3VR5D 4BB0A 4C4ZA 4CV2A 1F20A 3U7RA 5I4BA 4NV1A 2VP9A 2JIMA 3HHPA 2ZETA 2DYKA 4HGPA 5EEHA 4FJ2A 1T29A 2CN1A 5KX5A 1NGSA 5BR8K 1XA3A 2P79A 4JK3A 5H3CA 2E2WA 1UBLS 3H1VX 1L3IA 4CV1A 3ERCA 5ANRB 4C89A 1CFJA 3PUJA 4MYHA 3IAS6 2RG7A 2W83A 3PHHA 3QUQA 5DNWA 1XD2A 2VHEA 1V1MB 2PMFA 2XUHA 4L8GA 4M1WA 1SIWA 4QICA 2XH8A 4X65K 2DHDA 2BFNA 1PJLA 3FHJA 4LVNA 1GT6A 4TZKA 1KU0A 3NEJA 4H59A 1QH1A 1WOYA 2VSQA 1EJ0A 4M22A 5JCOA 2G9ZA 1RT6A 3Q2IA 3NF8A 4K8RB 1HFKA 3DWGA 2QN2A 4J2OA 5THKA 3I01M 5IWAK 3RK1A 3MCAA 3D64A 2ONKA 1RHJA 1U8FO 4WNYA 3I56N 3K9CA 4IGAA 1N3YA 1WD7A 4YBRA 4RBNA 4CT4B 1B42A 3JZIA 1GPJA 1AZSC 2WF9A 2ZSUA 1NVAA 2PSFA 2E6MA 4KLZA 1IZ0A 3HBMA 5TPWB 4ENUA 2JG3A 1G7CA 1IEWA 4RF3A 4V39A 4XD7D 2O8CA 1ORIA 4K3VA 1N2SA 4U7HA 5A0FA 3KJNA 4CW7A 5JWOA 3LPLA 4RFSB 3ZWCA 5KYXA 3WIDA 3HPGA 5DYWA 4EBFA 2CLEB 4AJ2A 1Q95A 5A7FA 3NDKA 4RVSA 4UEQA 1BE6A 2WHPB 2DZDA 4NHAA 1KC8O 3ITDA 3WLNA 4HAUA 5EHZA 2RAUA 4BXOB 1FRNA 2WWHA 2SKDA 3FFXA 3W7VA 1BTOA 5EC8A 3MHPA 3EZNA 3IDFA 3ZWXA 1LV8A 1RXIA 1MW9X 1JU4A 1TCAA 4LWPA 3EEBA 4GPZA 2OORA 3DB1A 4HDMA 4L16A 2BOVA 1CNEA 3M8PA 1SCJA 2M6RA 1I2AA 2QTBA 4IJMA 4RK1A 3TQCA 4RH0A 2C5FA 1Z82A 3GW8A 3GL1A 3RWOA 4JD2A 3EVNA 2PBDA 3REQB 3C7NB 2R8ZA 4DA8A 3NV9A 4DWWA 1XI2A 3BREA 4CZHA 3PDHA 4BFXA 5AUPB 5BV7A 4A5AA 2ZUUA 4WXMA 5IU6A 4FN5A 3GT7A 1MRNA 2GXSA 2QR3A 3C3EA 1J54A 3K71B 1LA2A 5EIXA 4LY6A 3U1TA 1QU3A 2D2XA 2CNBA 3LY9A 1UBNA 4XSVA 5CLHA 5BRDA 3L4KA 1E1QA 3A9WA 4GZLA 4PZYA 4RVUA 2X3UA 5FOVA 1PQWA 1YBMA 3KZCA 4ZOCA 4DZTA 1NRWA 2FOXA 2ZYSA 4NZOA 3M4YA 4XFKA 1IQRA 4F5YA 3HP4A 3TSCA 3QTBA 4WLVA 3TH5A 5CA0F 3GQBB 1VSTA 4NCJA 3OHRA 1UP4A 1ZXLA 4V19S 1XZHA 1L7PA 2PIAA 1NGBA 2VWHA 1V39A 4DR3K 2Z2KA 2IHYA 3EUFA 2WB2A 3CRVA 3F8WA 5KNBA 1OB5A 4C8OA 2AEFA 2ONJA 4E1AA 5JICA 1DAHA 2Q5JA 3ZE6A 2PH5A 2UVPA 1U0OC 5JBQA 1QRSA 3QIRA 1IKVA 4BVKA 3I73A 4KQXA 1WNFA 1XQVA 3VGKA 2IGBA 2QD1A 3HV0A 3V7FA 4JV5B 4TV8B 2ZRNA 3C94A 2QRKA 1LBTA 4ILJA 1TKTA 3ANTA 3HM8A 2BZSA 2GPNA 2BMEA 2V5AA 1E1RA 2WUSA 5DGHA 4EKYA 3OF5A 5LUBA 1ZC6A 1A7JA 3VH4A 4PO8A 3DTVB 3QXJA 1JILA 1Z0UA 3B36A 4AROA 1TJ4A 2WAYA 4RX1A 1QOQB 3HUTA 1NVTA 3GRCA 1H2FA 3FF4A 1RBVA 1A5WA 5K3BA 2ZB3A 5GADl 2PGIA 4TYNA 2HXSA 3DAWA 2WIFA 3INYA 4D4JA 4PL7A 1HNWB 4WQ5C 5CYQA 4KO8A 1E1NA 3B9PA 3F4LA 4WBSA 5EP4A 3V1KA 5LXTB 3ESZA 3GLUA 4EUHA 1NYQA 4MP3A 4MS4A 1AN9A 5CX4A 2Q3EA 4ID1A 1GGEA 4EO4A 1G99A 3FTDA 1ZFNA 1I5RA 1PS9A 1PSDA 3LWZA 4G1FA 3W2EA 1L3VA 3LDFA 1K3TA 5BORA 4UE6A 2RHGB 3MN9A 2C5EA 4GVLA 4BWGA 4Q4HB 1EDZA 2Y77A 3TU5A 3ZTWA 5K0LA 3L7BA 5B1IA 3RVOA 3WNDA 5C8VA 2CEKA 4UUBA 4CMEA 4ER3A 3HH8A 1CXQA 3C4JA 4R0MA 1XMOK 1EP4A 4A91A 4RJTA 2HLDA 3NKVA 2PLAA 1JI0A 1Z2AA 4IIBA 1CW2B 4KAAA 4NY1A 1VB5A 3L8MA 1L1RA 1Y8RB 5HMMA 1LLQA 3F96A 3DONA 1Y3AA 2VDWB 3EA0A 3TI9A 4DEYA 1K98A 4IS2A 1O4VA 2X7JA 2ZR7A 3AERA 3L04A 1HDYA 2JFFA 3UJBA 1R0BA 1X86B 1P0IA 2E88A 2EWSA 1KDPA 1IQUA 1G2QA 1N9GB 1UZMA 3BQNB 5JS2A 2CBGA 4R1LA 4RACA 5FNVB 3ZSXA 3F7NA 3VOVA 4GZ3A 1V4VA 1XRPA 3OAAA 4JLPA 4IIGA 2B6NA 1TF5A 1UWKA 3NHMA 1TKCA 1Q3KA 2JI4A 2H4HA 1U3DA 2ZB7A 3OZBA 4O2LA 1MTOA 2RIRA 4R40A 5CVUA 1WZNA 3M4NA 3VDXA 1TIBA 5EZYF 2OAP1 4JVLA 3TX2A 4REMA 4EG0A 3IPRA 1N3BA 1NXOA 4RH1A 1QIDA 4I5GA 3NCIA 1QHSA 4AWBA 1UK8A 1FLVA 3KSDO 4LPKA 1ZGGA 4UZEA 4FUQA 5LXTA 5H8WA 1WM1A 3O9MA 5C0YA 4JL5A 2HA0A 5FA6A 5H0IA 1ATNA 2C61A 1JN0A 2ILVA 3P9QA 3AY7A 4KQ9A 4C23A 1OPXA 4X44A 5KOJA 3C5WP 3JWEA 3L9WA 3ID6A 3LKBA 4UEWA 5G4KB 4YFUA 3WKAA 4EY5A 2YZMA 4YORA 1U81A 3A7EA 3UMBA 3WP1B 3LPNA 5GVSA 2BCJQ 3P2YA 1DRVA 1TJYA 3O74A 4JBLA 4JVMA 5F5LA 3RVMA 3UATA 5B7GA 2D59A 4XUGB 3ENVA 3IKMB 3D6UA 1JLMA 4KE7A 1XWLA 2DE0X 1A9RA 2F3QA 4ND6A 4DLXA 4KXWA 2Q21A 4JI7B 1RDDA 2J6HA 3SQ0A 1DL5A 2R6CA 2A8YA 3CCCA 3DEKA 3QBXA 2JFNA 1T9GS 5DLQC 5KAMA 3WLKX 4CWAA 4CEJA 3O0TA 4WINA 3D2EB 3STUA 1WBBA 2HHSA 1Q0ZA 4FNAA 1L4GA 2NP6A 2WMOB 2Z2YA 3TN7A 2JFXA 3NHKA 2EKQA 3ND9A 2XADA 3CBGA 4A92A 5LL6Z 4MWDA 1OH5A 2OG2A 3EODA 2DY4A 2F3RA 4BV9A 4J16A 3TCXB 1C9DB 5EINA 4E7JA 1GKUB 4CM4A 4DQ0A 1MXHA 2ZYRA 6LDHA 5LWQA 3VR4D 5DYTA 4CBUA 5AKHA 3G2QA 3FYUA 3Q4GA 4WY8A 4EY6A 1EKEA 3VOAA 1W73A 1LCUA 5AQXA 2AF4C 4DLGA 2NU7A 1D1PA 4UDOA 1LWEA 4W8GA 3I6QA 4WXEA 4A1FA 2Q4BA 4EB6B 4CHNA 5F2EA 3UFXA 1NMQA 4QXPA 2Q2WA 2HBJA 1ZWLA 2B9VA 4KQ6A 3P9KA 1IZ9A 2VXCA 4J2HA 4AJOA 3L7KA 3BTOA 5DNAA 3X1MA 1KNXA 3JQRA 4KCGA 3W8EA 4FUTA 4M1OA 5DU2A 4PLFA 4AP6A 4BJ6A 4C0KA 1ISFA 3I04A 3TECE 3KTOA 5LDHA 5GAGP 2W0SA 5BN1A 1PFYA 3DR5A 1TT7A 1V9CA 2B30A 4RM3A 4B3RB 2XWJI 1LFDB 2JLQA 1D0IA 3VDRA 3DJYA 3M6FA 2CLMB 1LLCA 4IDBA 3QELB 3F73A 4JKEA 1OLXB 5HBRA 3RYFB 4AY6A 1W85A 4KSYA 4U7GA 1U8AA 4I5DA 4C6RA 1TE2A 2XXBA 3UCXA 1U4BA 5F35A 5A9RA 1JG6A 1OT5A 1O87A 2OHOA 3FWYA 3DHYA 3P4IA 3GA5A 3QXXA 4TUYF 1F7VA 4I2PA 1S1MA 2FH5B 5AJHA 2NUBA 3L6QA 1ZLYA 5DLYA 5G4KA 4DG8A 1UOQA 1X1BA 2VNKA 1V43A 2ZULA 3DR3A 5KX5B 1XDZA 1JXMA 4HD8A 3ONDA 3U1BA 5AW9A 2BGTA 1PL6A 1SC9A 5KOHA 4DSZA 1ARZA 4KO3S 3EXHA 4CQMA 1DEKA 4BQFA 2G1PA 3OU6A 1SS6A 4ZMSA 3FR0A 2JJ2A 5JZOA 1KJIA 4OXRA 1CB7A 3TAXA 1DG1G 2ZRKA 1QZZA 3KJEA 3KYDA 4GBJA 3PC7A 1W29A 1VKNA 1IN1A 4Z4QA 3JPWA 4Y2PA 1CUDA 2NQ2C 1GADO 5GIPA 1NPDA 2DVMA 3HN6A 3MB8A 4WNAA 4TKVB 2HT1A 4MJXA 4XVRA 2O2CA 4LNHA 4Y2SA 1A50B 3CG0A 4I8DA 4TQGA 1A5ZA 3OUUA 1U0FA 3UJPA 1QIIA 1H0HA 5E84A 3LP1A 1JHDA 4RVCA 4BFTA 3K1ZA 4DFKA 2XKBA 3CZAA 3BAZA 4L1KA 5ED4A 3NHUA 4C1BA 2FZVA 1UBSB 3DO5A 3USCS 3HJFA 1P9LA 4BRAA 4FWKA 3QEWA 4H4CA 4HDMB 1EH5A 2EGUA 2YY6A 5E6SB 4JITA 4DBLE 4Z4FA 1T9CA 5FOWA 5A0VA 4R81A 3O75A 4NPAA 2R66A 5KWJA 4NU5A 1EQAA 4Q7KA 4LF8B 1YB6A 3FTQA 3W2TA 5JFOA 1ZKMA 1FUIA 3VU1A 4QQNA 2LV8A 5B4VA 1C30B 2X9LA 4N7JA 4TTVA 4OXIA 4MNTA 5KJEA 4DDKA 1CJCA 3P9CA 5REQA 2DSNA 1JWAB 5IXJA 3EDYA 1NKBA 1AKNA 4LYYA 4ZGWA 3BL5A 2PNFA 5GMOA 2Y0PA 4F7WA 4BLSA 3U4DA 3EXEB 1QE1A 1WF3A 2R7KA 2UXDK 3H2JA 3KL2A 4NE7A 4PG7A 3TL6A 5B7NA 3L8ZA 5FPTA 1QSYA 2G71A 2CYBA 2XY7A 5DHSA 4LCBA 2WLTA 4ROTA 5AM0A 3FZYA 1EK2A 4BXOA 1B2RA 4DV5B 4C7XA 3VI3B 1K5DA 2DPLA 1MIHA 3LPTA 1AG9A 4FYKA 1PLJA 2ES4A 4MUEA 2PMWB 4Y0VA 5EE3A 5H4HA 1O0BA 3T3IA 1AUQA 4P36A 1Y3DE 2DHCA 2EOAA 5AQEA 1XYGA 4B3TK 5D3KA 3AO0B 5DCYA 1QVAA 3EN9A 2IF0A 2X8AA 2BFFA 3BWDD 3RG2A 2QRGA 3RJTA 1ZBSA 3N2NA 1P19A 1YS2X 4JJ6A 4L2IA 1Y1PA 4K87A 4PRKA 3SR4A 4RCYA 4XRGA 4KR7A 4BZQA 4YT5A 4JD2B 3C3KA 2Q3SA 1FP1D 4KPYA 4ZKDA 2ZXEA 2BI8A 2XHZA 4PQRA 4GMFA 5CHYA 4R3NA 3UMVA 4NCKA 5JVDF 2JBAB 4AF1A 4EPTA 1SA0A 3R8XA 3E5MA 1SUCA 2XRFA 3PQ2A 4XZ3A 1YAJA 4L1PA 3RGGA 3T7ZA 1ZOLA 4J8PA 1HR0K 2DCMA 3LA8A 4JR0A 1X7WA 3IMCA 4MUKA 2LE0A 3LP8A 2GZRA 3CCJN 1D03A 1FS4A 1Z4KA 4L0QA 4BAZA 1CRPA 4FWOA 4D25A 3UICA 2CXTA 2LSNA 2AZ4A 4G0YA 5AUQA 3O92A 1CR0A 4C7OA 3HGQA 2LIPA 4ND4A 5KQGA 2R8XA 2VJYA 1QH0A 1VMAA 5H82A 3VPZA 4KMMA 4MRAA 3UK6A 1Z07A 2ZIXA 5IHPA 2HBRA 3CPWM 1UJMA 2P69A 2EIXA 4WK6A 3F5QA 3PSAA 3STHA 3RUIA 2BEJA 4ENRA 3EGWA 4DSAA 2HCJB 1QS0A 3VU0A 2HLNA 3P1JA 4QRIA 4PZUA 5DSTA 3TRIA 3UFBA 3V8EA 4HAZA 5KC8A 4FGWA 3N6VA 1SG6A 4IJWA 1NC3A 3G5UA 1UBUS 3A2LA 3LY8A 3PUVA 1BXGB 4GR5A 1N6KA 5K0SA 2W43A 2PGOA 5EVCA 1GLDG 1E9VA 4MVJM 4O63O 4D0GA 1CEYA 2WZBA 1JA1A 2KS6A 3P5SA 4L7VA 3AIIA 3RS5A 3LE8A 2NVUA 4Q4DA 3QVMA 4I5EA 4WGFA 1YIAA 5BWNA 3PICA 3HCCA 3QVXA 5C81A 1YMQA 3K09C 4FTWA 1RC1A 2G8IA 2PXHA 2J3MA 4OTZA 4OM7A 4LHYA 5EOVA 5J2TB 5BMOA 2FDCA 4KR2A 1C9EA 3NETA 3QHQA 4IHQA 1R8JA 1NBEA 4RHEA 1FTNA 4RKQA 4FBMA 3TTCA 2IOFA 3HU5A 3B1VA 3PGKA 5ALXA 1J70A 5JMOA 1Y9JA 1L4MA 1KFDA 4NCBA 1NXVA 1UBMS 2PU5A 3BH6A 3K96A 4LJ8A 4NMXB 3ZGLA 4DCPA 5M1PA 4Z4EA 3K6KA 4OH1A 4OQZA 4E31A 2IH5A 4OKKA 4GUAA 2H63A 1CEEA 2X78A 3ASYA 3WWCA 4LE1A 1CVLA 3IEPA 3K2QA 1U3VA 3H5VA 3K20A 3K8ZA 2AG1A 5JH7F 3OJWA 5BSHA 3WXMB 2V45A 4H3KB 3W8RA 1BWRA 1NLFA 2QNIA 3T3FA 2VUHB 2IEBA 3PFWO 5TV2A 4I8IA 1C41A 4TSRA 5F12A 1QS4A 1YCDA 4P3PA 2VPTA 1P33A 4B3DA 2AVNA 3VISA 2V55B 4PBTA 1LUAA 1ANKA 4BFZA 1OZAA 3BEDA 1OBFO 4I4LA 1SZPA 2E55A 5AVKA 2OB2A 5GM2A 2Q4EA 4RXUA 2XQVA 4I2VA 5SY4A 1UPAA 4GI2A 4DCGA 2AOTA 4F12A 5J4HA 4BRPA 4LF5B 4NH5A 1PAUA 1QIFA 2VT2A 3N59A 4LS3A 1GU7A 1V16A 4PKGA 5LN1A 1SH7A 2QUKA 2E89A 2PWBA 4ZI5A 4B3IA 4Q9LA 2C84A 4LZLA 3O3NB 1VE7A 4LZJA 1K2WA 3VRHA 1E4VA 4XM2A 4B44A 4PX2A 2A9PA 4ISCA 4C8MA 2FBTA 1MQAA 3G9QA 1XDBA 5AHKA 1SUDA 5KDDA 5TMEA 3CUTA 1RRCA 5ALRA 4E22A 1DXQA 4NJMB 4PLWA 3UW3A 1GTSA 3QKTA 4P9NA 5AFSA 1JSLA 1P3Y1 1YRWA 3COWA 3SLKA 2ECPA 3JWHA 3AP2A 4D6XA 3AF6A 4TV9A 1JL2A 2WIJA 1RYMA 1JKXA 4TRRA 5JDIC 3F2KA 5AQ1A 3EC2A 3A04A 1R66A 1NG1A 4YQYA 3THXA 3PFFA 3AJRA 5T4BA 1WMAA 1QB8A 4CESA 4R0VA 4RD2A 1RAFA 2I2FA 2XMGA 3KKMA 4CUKA 5C4MA 2WSLA 5JXGA 2B82A 1TO2E 5HR5A 1MV5A 3LDSA 3EEIA 5JSQA 4Q4AA 2WJWA 1GPKA 4UM8B 1Z37A 1MQ8B 4UTVA 2WLSA 3IAM1 3CHWA 3C8ZA 4NX2A 1JXEA 3DBOB 4FSDA 2QG6A 4RHUA 4W8HA 1E9SA 4G37A 1NLZA 4IDDA 5D3MA 3QEMB 4YRSA 4B2YA 4UCFA 1V35A 4TV9F 4B76A 5EJMA 4BKMA 4DLPA 4HTUA 3ISJA 1T9HA 3BGWA 2AJ8A 1UFVA 3LW8A 4OPMA 1KKUA 1YE3A 2DHRA 3A0UA 4EG8A 2WQ7A 1IXYA 3SQ1A 3GV0A 1N34B 3OZDA 4I7EA 4DA0A 4JP5A 4HV4A 3TJRA 3SCXA 4P31A 5BR9A 1Z5VA 4MCJA 5DHRA 5MF6A 4RMIA 1D9FA 4L4UA 4JEHA 1SELA 2GJAA 1DWQA 1RDUA 2MYUA 2XE6A 4UHEA 2D5LA 5REQB 3SC3A 4F6RA 2VRWA 3B1FA 4Q18A 2F64A 2O2EA 4Z0TA 3RC1A 2R5WA 1NK0A 3LLUA 4LXXA 1K89A 4TMXA 1OGYA 4WBXC 1Y8AA 2HO5A 1T25A 3BJZA 3DRRA 4NHOA 4COKA 3N9IA 3ZY6A 2GELA 1GNSA 4DKXA 4QYMA 2JK0A 5C1BA 3KXDA 4RIHA 1Z0AA 3ASZA 5U4XA 2IWRA 3WK6A 2DTDA 1EESA 3GZNA 5MDHA 2WIKA 1HGXA 3IIEA 1F2UA 4RL4A 4Y1GA 1SCIA 1T3TA 4DF3A 3SMVA 3A4VA 4AIIA 3E7XA 4KRXA 5I45A 4IDKA 1YZQA 2YYZA 3OCWA 2IYWA 3T15A 1J2JA 2ZF5O 1IM8A 2BUBA 2WSBA 3I2IA 3O47A 1E3SA 3IA2A 3MQ2A 1FTGA 1HJOA 3QITA 1K7XB 3DDUA 4HRVA 2HXGA 1W19A 3QESA 3K8OE 4HNHA 1RYNA 4FWIB 4E88A 2GJKA 2BJWA 1C9YA 2DUMA 2CGJA 3KQOA 5B58C 3TSQA 5JS8A 4WCDA 1G20A 3CCVN 4FPXA 1REQA 4JP8A 1DAOA 1KFCB 1QRUA 4CKCA 4CZ2A 3AFOA 5C1PA 3N0WA 2PXCA 1KBOA 3PDUA 1KXJA 3D1JA 2MYTA 1H6CA 5GM1A 1DXHA 4JKGB 2HRBA 2KI5A 4BOYA 4HGRA 3WQSB 1FY2A 4JKBA 4DC0A 3DHVA 4OHVA 2ORIA 3QVJA 1P4SA 2OFFA 3TLJA 3TNDA 1AHHA 3TR0A 4H0OA 3U13A 5AW7A 1Q7BA 3NIBA 4HWTA 3ZIUA 5I8PA 2AZDA 4S1NA 2F4VB 3PX0A 1KS9A 2FMKA 4TN1A 4H5RA 5FROA 5C24A 2YJ4A 4HMQA 3T5MA 3TZQA 4CIXA 3A5NC 1Y8ZA 1CS0A 3F5DA 4IEIA 1QCYA 1I94K 1QKKA 1KWGA 4MV3A 4G5GA 2IIBA 2IC3A 1SU8A 2PKEA 2BGUA 4INPA 1DFIA 4LTNA 4WA8A 2PKXA 3UB5A 3B1ZA 1KQSM 3MCWA 2XRMA 4OSEA 5CM9C 2Q2RA 5AKZA 1VKZA 1M7BA 4QELA 3W5VA 3V8NA 1U3CA 2DT5A 3T1QA 5EJIA 5KHAA 2GUIA 2OP0A 4MB0A 3UQZA 4IUBS 1R6DA 1A7UA 3H5TA 3H2IA 2NU6B 2GN6A 3D1VA 1C0LA 1X7YA 5JPCA 4MYTA 2XHEA 4DR4K 1FP6A 4K9LA 4U7FA 4G81A 4R2WA 3SVZA 3I6MA 2IELA 3PL1A 4PZEA 3BM5A 4WIAA 2BEVB 1VLZA 2FLKA 2OQVA 1N8NA 1D2HA 2HF8A 1MJFA 4P7GA 4QU9A 5JVHL 4D8WA 5KNBH 3NAEA 3AO1A 1QS0B 3EXG1 1PZFA 1VZ2A 2HFKA 4AJKA 2WAAA 3N0TA 4IIXA 5AHXA 5B1SA 3C24A 3LTNC 2NUAB 1ULBA 5TVKA 2GK4A 3W2FA 5BNTA 5HDBB 3PO5A 2OV3A 4JLKA 1K5GA 1QPGA 3HCRA 4F6LA 2JBAA 1VOTA 1ECFA 1JYFA 3CNEA 3AOEC 4V3BA 5EUCA 4BFCA 1S1WA 4NH0A 5HK9A 2WMDA 3H9JA 4DL9A 5BV1A 1GWNA 4LHXA 3TD2A 5FTKA 1P1HA 2GN4A 2N0SA 2JGAA 2PSJA 4HADA 4XTRA 1BWQA 1XTSA 3BMXA 4NKRA 1CHDA 1DTQA 3EXIB 5DJ5A 2EWVA 5FO0A 4TSXA 2Y1IA 2QZ9A 4BWYA 3AI7A 2IP1A 3U80A 4KWCA 4DBVO 2I8CA 3GN2A 5P8WA 3BRSA 3JCZA 3V4IA 1GZSA 4W4TA 4HJRA 1Z4NA 4A23A 1PS0A 4BNWA 4N0MA 3L7JA 1Z05A 4BREA 1EINA 1WXHA 2C3OA 1Z39A 1ACLA 3Q2OA 4GL4A 5DN9A 1JT2A 3CSUA 2RJOA 3CJAA 1V1RB 2AXPA 3GOQA 3IEKA 4OHKA 5J9FA 4CMAA 1L4FA 2BFFB 2LKCA 2VYVD 2ACVA 2VSOA 4J16C 1RAAA 3GFFA 2XNHA 1T2AA 4PTZA 4RADA 1P1FA 1QFJA 1E8MA 2D1QA 5G3ZA 4KQMA 3NFRA 1RS0A 4ESEA 3BD7A 4EKGA 4X0EA 1DKRA 3A27A 4P1ZA 5BSGA 1L2TA 4DUZK 1Z5OA 3I4LA 4P22A 4LOAA 1VHXA 1L8LA 2C2ZA 1QVVA 3B1XA 5M34A 3I92A 4UBJA 1OLUB 1RADA 3PRKE 4YP5A 3TRHA 2XRZA 4FYHA 1M0SA 4DTNA 3CX4A 1DGQA 5CEFA 1WHTB 2Q0HA 4K6CA 2RH4A 2HWXA 2OFOA 4HDNA 1ZH6A 5JSKA 1XMQB 3Q9SA 1LK7A 1A7AA 3SUQA 4V0LA 3DBRA 3QU5A 4UBMA 4A1OA 2JGUA 2AV6A 2W8ZA 2YV2A 1SKQA 4MUXA 4WD3A 1J90A 1GLVA 1VL2A 2D00A 4HOYA 4RORA 3P0RA 2QLFA 2X9NA 1UIMA 2ASOA 1LBIA 2YXBA 4KN9S 3KWFA 5EHQA 2VHUA 4X91A 1ZGJA 2PRKA 1IG8A 2VCYA 2WF6A 3FSEA 3L0ZA 2QWRA 1LPMA 3BILA 5BW8A 2ERYA 3K5WA 3PRHA 3Q40A 5H5JA 2UYHA 1JKJB 2FW1A 1HNXB 1Y5MA 2YNMD 3DT9A 4WYBA 4HGZA 4QGHA 4Y2VA 4YRRA 3TTXA 2PRIA 3GJ8A 1PN3A 2HIAA 4CJ5A 1EVZA 3EK2A 3HGMA 4IJUA 3A6HA 3OJ0A 1TKXA 2K2WA 5G02A 1NK5A 3LAKA 4GP6A 1WR8A 5J5CA 1OFUA 2CV0A 2QQ5A 4CEEA 3ZSWA 5ALVA 2EDCA 5CX1B 1QLWA 4GT1A 4YRJA 1S3IA 3L4EA 5BN8A 1YZ3A 3F5FA 4GZ5A 4IXDA 3IOYA 3VYUB 1GEGA 2B4TO 1D4OA 1S6PA 3MDQA 1CDDA 2ZWHA 1P75A 2OTLN 3ZDCA 4O0IA 2DBQA 2I34A 2J9GA 2Y68A 3NWOA 3OBBA 2YV1A 2ARKA 2FF6A 1CY8A 1SZJG 4O5AA 4E2WA 2BKUA 1VQ5N 1BGWA 1XQSC 1H2RS 3LY7A 4ETWA 3FMVA 3KWIA 2QD2A 1Y5NA 3FD8A 2FW7A 1H4QA 2QTMA 2F9FA 2P68A 4LF6B 1LI4A 1D2GA 5JEEA 2B99A 2GAFA 2VQEK 1NW8A 3DZBA 3K1YA 3PWZA 4KWIA 1YTUA 4D7AA 1SOVA 4ILKA 1LDEA 1J24A 1JIIA 2IU4A 2R0QC 1UFRA