5T7BA

Argonaute-2 - 5'-(e)-vinylphosphonate 2'-o-methyl-uridine modified mrttr guide rna complex
Total Genus 227
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively.

Total Genus
227
sequence length
837
structure length
802
Chain Sequence
FKPPPRPDFGTSGRTIKLQANFFEMDIPKIDIYHYELDIKPEKCPRRVNREIVEHMVQHFKTQIFGDRKPVFDGRKNLYTAMPLPIGRDKVELEVTLPIFKVSIKWVSCVSLQALHDALSGRLPSVPFETIQALDVVMRHLPSMRYTPVGRSFFTASSNPLGGGREVWFGFHQSVRPSLWKMMLNIDVSATAFYKAQPVIEFVCEVLDFKSIEKPLTDSQRVKFTKEIKGLKVEITHCKRKYRVCNVTRRPASHQTFPLQQESGQTVECTVAQYFKDRHKLVLRYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIRATARSAPDRQEEISKLMRSASFNTDPYVREFGIMVKDEMTDVTGRVLQPPSILYGGRNKAIATPVQGVWDMRNKQFHTGIEIKVWAIACFAPQRQCTEVHLKSFTEQLRKISRDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYAGLQLVVVILPGKTPVYAEVKRVGDTVLGMATQCVQMKNVQRTTPQTLSNLCLKINVKLGGVNNILLPQGRPPVFQQPVIFLGANVTHPPKKPSIAAVVGSMDAHPNRYCATVRVQQHRQEIIQDLAAMVRELLIQFYKSTRFKPTRIIFYRNGVSEGQFQQVLHHELLAIREACIKLEKDYQPGITFIVVQKRHHTRLFCTDKNERVGKSGNIPAGTTVDTKITHPTEFDFYLCSHAGIQGTSRPSHYHVLWDDNRFSSDELQILTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKRDHQALAKAVQVHQDTLRTMYFA
Loading diagram...

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

molecule keywords RNA (UVP)UAUAGAGCAAGAACACUGUU
publication title Protein structure
rcsb
source organism Homo sapiens
molecule tags Hydrolase/rna
total genus 227
structure length 802
sequence length 837
ec nomenclature ec 3.1.26.n2: Argonaute-2.
pdb deposition date 2016-09-02

pfam database annotations

chain Pfam Accession Code Pfam Family Identifier Pfam Description
A PF02170 PAZ PAZ domain
A PF02171 Piwi Piwi domain
A PF08699 ArgoL1 Argonaute linker 1 domain
A PF16486 ArgoN N-terminal domain of argonaute
A PF16487 ArgoMid Mid domain of argonaute
A PF16488 ArgoL2 Argonaute linker 2 domain
Image from the rcsb pdb (www.rcsb.org)
cath code
ClassArchitectureTopologyHomologyDomain
2.170.260.10 Mainly Beta Beta Complex paz domain paz domain 5t7bA02
3.30.420.10 Alpha Beta 2-Layer Sandwich Nucleotidyltransferase; domain 5 Ribonuclease H-like superfamily/Ribonuclease H 5t7bA04
3.40.50.2300 Alpha Beta 3-Layer(aba) Sandwich Rossmann fold Rossmann fold 5t7bA03
4KHUA 2YHAA 4LD0A 5FBKA 5KQGA 5D2CA 4Q5VA 2FBVA 1HMVA 2ITGA 4Z9BA 3EZ5A 4DFPA 1B00A 5FRNA 4EP5A 4XASA 4FW1A 4CFCA 3V9UA 2HQBA 1L5YA 4N41A 2I6FA 2N9UA 3B6PA 1ZHHA 3AVKA 4KQCA 1VSDA 2NT4A 3LALA 3ZSRA 3OYMA 3SNNA 5DK5A 3OYLA 1Z17A 4FYDA 2GBPA 1YK0A 2O4IA 1ZYQA 4AHTA 4BE1A 1ZBLA 1NK8A 4HCCA 4CIEA 4TSXA 3MMNA 3LZJA 1J56A 1UA1A 1EXQA 4DU4A 3QELB 3VQ9A 3AO5A 3Q15C 1YS7A 2WONA 1GCGA 1Z2EA 2WOMA 2FXIA 2IYNA 1GOAA 4DQQA 4MQ3A 4KQ9A 4KV7A 4NV3A 5F64A 5HSGA 3SI6A 1W9HA 2PY5A 4C8KA 1C0MA 4NGFA 4RW9A 1RDAA 5CNKA 1LV5A 2XY7A 2IPAB 1SI3A 1NK0A 2FLWA 4W5TA 3NDKA 3L2WA 4I9QA 4H3KB 2PUGA 4B9VA 6CHYA 2KQ2A 3EYZA 3QLUA 2RDMA 1TK8A 4JRQA 2O4GA 5I42A 1NK4A 1NK9A 3QIPA 1VK0A 4FLWA 4DTJA 1J9AA 3E01A 1IKYA 2FQXA 2WB4A 4P1ZA 1CZBA 4MLDA 2P4UA 5K14A 4EYGA 3H75A 2CWDA 4CGIA 4GNRA 1C0UA 4IMJB 8ABPA 1JWLA 2QW1A 1HYZA 4N76A 2LBPA 3D0PA 4CERA 4OG2A 4QYWA 2PL9A 4F12A 4Q7EA 1K6YA 3AVGA 7ABPA 5CNJA 4XARA 3HDVA 1IG9A 2JVIA 1NXWA 3S3OA 3RVRA 4KB1A 3KG2A 2IOCA 3HUTA 1M2FA 4EZ6A 3JS5A 2HVHA 1Y1LA 1SXIA 3QINA 4Q6BA 2YNHA 3CFOA 1Z18A 5KRSA 1L5ZA 3CYMA 4DTUA 1GOCA 4I2QA 4KMRA 4E7LA 3QLVC 1C4WA 3UK0A 4B9TA 4NHAA 5GOTA 3T1AA 4YNQA 1VSJA 3HPGA 5IBQA 1JKHA 2Q3SA 3O74A 3R0JA 3NNNA 4DLGA 2MYPA 2R4QA 5HQJA 2GX6A 4Q0BA 4CEAA 3SQNA 4IBNA 4I7FA 3LKVA 1VSFA 4O0JA 1S8NA 3RMAA 2X74A 3OO0A 5HROA 3CZ5A 3NHZA 1SKSA 5KQLA 4CEOA 4E7IA 4JASB 3DZDA 2W42A 4HNSA 3MECA 3QEMA 3ZT2A 5C25A 3BDPA 1TL1A 4UQGA 4OATA 3IPCA 1TM2A 3LKBA 2FEKA 2VWKA 2OPRA 3IDOA 1KTQA 4KK4A 3A10A 5EU7A 4CEEA 1IKXA 3ISNC 3OYKA 3AVCA 2CHEA 2PUFA 5FWYA 3NH2A 3OYBA 3OYDA 2HHQA 1Z16A 4G0YA 3NH1A 1JYEA 1UDRA 1QMPA 4QCLA 1TVRA 2E4ZA 3CFRA 2E6LA 3S9HA 4MLCA 3QEXA 5FWXB 4FM1A 4RY9A 2PUBA 1M5TA 1O1WA 1R4KA 3V81A 4DADA 2LSNA 1RNLA 3C3MA 2H3HA 4CK2A 1RBSA 1IKWA 4Z0UA 3KD1E 2H0AA 3L2UA 2P51A 5PNTA 3U3GA 1D9FA 1DCMA 3H5LA 4B8AB 4PWDA 2MYTA 4PA1A 4CJKA 4FM0A 5EWJB 3MF4A 1ITGA 1F21A 4MQEB 4KPYA 1MIHA 1KRXA 3DLGA 4CJEA 2IOYA 5TPWB 1GUBA 3D45A 2L18A 4G0QA 4FLUA 3CHYA 3GT7A 3OYFA 1TAQA 1U2PA 3MEDA 3AO3A 4DF8A 2P5OA 1X9SA 1QQAA 2QVCA 4ETMA 3JPWA 2G8VA 4HUGA 3MXMA 1Z2DA 4LE2A 4KK3A 4M3TA 2E4YA 2PUAA 1CZ9A 1DLOA 3CG4A 4CGFA 4EUKA 3SUQA 4DSIA 3DOLA 3MA0A 4Z4GA 1FFSA 4RKRA 3A0UA 4FJXA 1GOBA 4LDAA 4WXEA 3MAQA 3H5WA 1EP4A 2OZSA 4F3OA 1EWTA 3C6TA 4E89A 4DMNA 2FKAA 1TLFA 1QSLA 4JB0A 3HEBA 1I3CA 4IFVA 3UKJA 2MYUA 5EWMB 3KCNA 1WAFA 4CCHA 3K4HA 1TV6A 3TAEA 3TAMA 3KLHA 3GA5A 3QESA 1B92A 4CJ3A 5I3UA 1MB3A 4ZTJA 4CJPA 5BQ3A 4CBVA 3SQ4A 3NF7A 5J2PA 1NKEA 1MAVA 5JNUA 3NHGA 4PQUA 2LUOA 3HK2A 1NXSA 1RNHA 1RT2A 1TKXA 1SXGA 1DTTA 3IAYA 1REVA 5HP1A 1J54A 1JFVA 3DRPA 1ZBUA 4GPAA 3BRSA 4CGDA 1LJLA 3CQ8A 3DGEC 4KFCA 4MPTA 4BWJA 1NOYA 4PZ0A 4MFBA 3VQEA 2FN9A 4MS4B 2R47A 3QLHA 3PY8A 2FQWA 2JVKA 3JTEA 1X1PA 2R48A 1TVMA 3OYNA 2ETJA 1LWCA 1QNLA 3CS3A 2XO7A 5KWSA 2B6AA 4KFBA 3CLKA 3QEVA 4CJ5A 3F9KA 4RSMA 4OLAA 3M8PA 3V1RA 4FJLA 4BACA 1BGXT 4Y9TA 1A0OA 1VRTA 4OGCA 2G8WA 1SRRA 1FXXA 3NF8A 4LE1A 4G1QA 4CEZA 4NQRA 3OQOA 1MB0A 3LPTA 3TO5A 1XHFA 4G0ZA 3QNNA 4CJLA 4ID1A 3DLBA 3RMBA 4OGEA 1DP4A 1JXEA 4ELUA 2HPHA 2G8HA 3KKRA 2V0NA 4JOQA 1MU2A 2KFZA 1N5YA 2AJQA 3CG7A 4CHPA 3KK2A 1B9FA 2PUDA 5CY4A 4WWHA 1QP7A 4IRXA 1TKZA 4OKJA 3VQ7A 2GI4A 4YFUA 3GRCA 4KB0A 4RG8A 4QAGA 4KHYA 3F6CA 2Z1IA 3SQ2A 3VQ5A 1ZH4A 3L3VA 1D9DA 3Q7SA 1SD5A 4FLYA 2NT3A 4RW7A 3GL9A 2CD7A 4CK1A 3K2PA 2EHGA 2GBZA 3KIOA 3OYJA 1BIZA 4OVLA 4CF1A 1N6QA 3GV0A 4MQFB 4IMIB 5JS2A 5DGCA 3KK3A 2OYQA 1WSJA 2RJOA 1EWKA 1RT3A 3LP2A 1BQNA 1E6MA 4HNQA 2X78A 2DFFA 3EQZA 2HHVA 4BDZA 1DZ3A 4KTZA 1D2AA 3AO1A 4NGDA 4KVFA 1JFTA 2PKXA 3TARA 1QP4A 1F4VA 3ZT0A 1B9DA 3DI6A 1D5WA 5FDLA 3P5JA 3RVKA 4M3YA 4ZJPA 3V6DA 3JSMA 3DLEA 2IPLA 1YTAA 1C1CA 3HO1A 5TPZA 1QQBA 2Y1JA 1D4ZA 3KSMA 1VKRA 1ABEA 5FROA 3O3GA 5IULC 1TK5A 4MR8A 5J1EA 3LAKA 1H9CA 4W5OA 3LZIA 1DRKA 4J2AA 1CEYA 1Y97A 4KHNA 3N8IA 3IP7A 2F96A 3VQ6A 1RCHA 3VNAA 3AO2A 4K8XA 4RV5A 4J2DA 2GUIA 3SUPA 2OZMA 3CRNA 2PLNA 1LAVA 3I0SA 1ZGGA 4Z4FA 2ZAYA 4O44A 2PAFA 4NH3A 5KC8A 2ZE2A 4RY0A 1T8EA 1KCFA 3BREA 2WJWA 2JK1A 3N75A 3TANA 3CNBA 2OPQA 3G0ZA 4CF8A 1BCMA 4M3RA 1JHZA 3WNFA 3O1JC 3ALYA 3O21A 3L6UA 3QERA 3DRSA 4FJ9A 1D1PA 3LUHA 4FXDA 4M3ZA 4DTRA 3LPUA 1FKOA 4DWIA 4ML3A 4CJUA 1NXTA 3TAQA 4WXMA 3NH0A 1BISA 3RR7A 3HP9A 1WSIA 1A04A 1OXKB 3SPYA 4M45A 4CHQA 5JNWA 2GKGA 4YR7A 1RPJA 5FWXA 3V1OA 5FBHA 1TKTA 4DS5A 1P2FA 1U2QA 3MQ4A 2QXFA 1U48A 3FGZA 5KI6A 3SV3A 4I9LA 3AVMA 2QSJA 4NGCA 2TMYA 3LTEA 4FJJA 4C8OA 4RK7A 2A9PA 2DFHA 2A1RA 1Z13A 1JLGA 4IF4A 4B9MA 4DLEA 4EYKA 3AVLA 3O7XA 1KRWA 3PX0A 1LW2A 3U3YA 4BWMA 5EWJA 1U45A 1JLEA 1IH7A 2IKSA 4MQEA 1L3TA 4NICA 1BL3A 5TPWA 3RRGA 4RW6A 4LH4A 4RW4A 4IFYA 4OJRA 1C0TA 2E4XA 3V9SA 3OLXA 1T2SA 1USGA 3UIQA 3Q7RA 2B5JA 2BGGA 3KS9A 1S1UA 3HVRA 3NGZA 4DQSA 1E6LA 4FK4A 4DS4A 4ZTFA 5HRSA 3HUUA 1RZRA 1JLFA 1VSEA 1R8JA 2JRLA 1E6KA 1YK1A 3AVIA 3I8DA 3O2QB 2FEPA 4O5BA 4DQIA 2VYCA 3EULA 1P8AA 3AA4A 1ZN2A 3CTPA 3DLKA 3OYEA 1LW0A 5EWMA 1HQEA 4NYFA 1HEYA 1U4BA 3JPYA 4CEDA 3EQ2A 3A3KA 4GMJB 4G0PA 3QLVA 2I5JA 1BDJA 4CJ4A 1LAWA 2MSWA 3IG1A 4YCSA 2NZUG 2VK2A 3TAPA 3KLEA 2F8TA 3M9WA 4LH5A 2QZJA 1SL1A 2KZMA 2VUIB 4HYEA 2HNDA 1NXPA 1RT7A 3E3MA 1S1TA 1JH9A 3NNDA 1GCAA 4RXTA 3ULDA 3ASMA 2ZWMA 4G0MA 4M3UA 1OXBB 2YNIA 4MS4A 4RXUA 2YKMA 1WSHA 1BQMA 1HQUA 5E41A 2WMYA 1FKPA 1R0AA 4NCAA 3O2SB 2OA8A 1RBUA 4EGSA 5JS1A 4B9UA 3OYCA 1K68A 4CGJA 1KFSA 4CECA 1WSEA 1ZDMA 3RVPA 2IGIA 4MGEA 4EYQA 1NK5A 3C94A 4S04A 3O3IX 1Z26A 5C5CA 3K57A 4CEFA 3LUFA 5DMRA 1CXQA 2FQYA 3OQNA 3CFPA 3LOPA 4AHRA 3DMJA 4O55A 5HBMA 3LP0A 1QQCA 4FLXA 4CJVA 3QLUC 4MR8B 2QVWA 3MXJA 4JP1A 2GWRA 4NGGA 4AH9A 2EX3A 1C6VA 4Y1CA 4RDCA 1L3UA 2E4WA 2L17A 4E1NA 3GYBA 3SJJA 4CEQA 4J2EA 2OPSA 4NYNA 4C8MA 1LBIA 3OYAA 4CF9A 1KLMA 1FK9A 3SNKA 1QS4A 4BDPA 4XLTA 4KV8A 5HRPA 4JS5A 1JYFA 4FLVA 1KRPA 4IGAA 1CXUA 3S99A 3IRXA 1RDBA 2FW0A 3HS3A 4CK3A 3OYGA 2D0CA 2PMCA 5HLFA 1USIA 4MQFA 4G0XA 3OJSA 4TLMB 3SCXA 2Y1IA 4CGHA 3DBIA 3KK1A 3Q41A 1IIBA 4FB4A 2JCGA 1NXVA 2G8IA 5KGXA 3CU5A 3UUGA 3OM1A 3O3FA 3AO4A 3CM6A 3M8SA 3KLOA 4IILA 4TMYA 5CZ2A 5JNSA 4YV7A 1J53A 3VQ4A 1SL2A 2FTKE 1W0HA 5DLEA 2PUEA 5JNTA 1SI2A 3TMYA 1RZRD 1L3SA 1JL3A 1QKKA 1NKBA 2A9QA 4EZ9A 4CFDA 3OLYA 4PEVA 4LZLA 2R25B 1P6QA 2ZD1A 3RVNA 2L5CA 4KTWA 3T6KA 1YT3A 4MRMB 1UAXA 5B3JC 2YKNA 2IDMA 1T03A 1DG9A 4L4UA 3DRRA 4J2BA 3N0WA 4N03A 2IAJA 3ZCMA 3N6VA 3I0RA 4CEBA 1NJYA 4QPJC 4C8LA 3V4IA 3FFIA 4CJSA 2FVYA 4Z4IA 1J5OA 5TE9A 2VG6A 3PUFA 3NAEA 1VSHA 4MR7B 3NBPA 1L5UA 3TAFA 3VNBA 4MR9B 1S6PA 2Z1GA 3O3HA 4DFMA 2NZVG 4L85A 4RK1A 3VQCA 3AVHA 1ZBHA 1SL0A 4NCBA 3HXMA 1EX4A 1K66A 2B1JA 2PYLA 2M1ZA 4HUFA 3BRQA 3MM4A 4JRPA 4W5NA 2Z1JA 1DCKA 4CF2A 5HRNA 3L8BA 4F2RA 4YWHA 5IEJA 3AA5X 3KLFA 2RPIA 4DN6A 3ZT3A 3CZCA 3H08A 1XWLA 3OJUA 1Q9XA 3EGCA 4CJRA 3RMCA 4E7JA 4NH5A 3H5VA 1FFWA 1A5VA 3OLWA 3FFXA 3QEPA 3SYZA 1S1VA 4FLTA 4XFKA 5DKFA 5IUJC 1BCOA 4JB2A 1YTUA 1JXBA 3G85A 1RBTA 3ZT1A 4RS3A 5CNIA 5JNRA 4I2PA 2XHBA 2YHBA 1VSMA 2HJ9A 4F2SA 3FMVA 3RVJA 1WSGA 3N53A 1YVUA 4CHNA 2MSLA 5GQSA 4W5QA 4G86A 3O1IC 3HDGA 3RVLA 3KTOA 3LWLA 3AVJA 1VSLA 3NF9A 3PX4A 1XHZA 2FSPA 3RWUA 4KTQA 2XRIA 1TJYA 3PX6A 3S3NA 1S5JA 4CHOA 3ZSVA 2HHXA 4M41A 3B6OA 3SQ1A 1XWWA 1HRHA 4RK6A 2QKKA 4RY8A 1JF8A 2HQRA 3TI0A 2PZSA 1EWVA 1T05A 4CESA 1DTQA 4GVMA 2QVGA 3O6EX 4KRFA 4E0DA 1BHLA 5BRAA 3P1GA 1T2RA 4KNYA 1S1XA 1DCFA 4F8RA 4AHUA 4XXHA 4M42A 2O20A 3LP3A 2FLKA 2FMHA 3BILA 1S9GA 3NNSA 4HHTA 1NXOA 1ZBFA 1Z25A 5CYMA 2MSKA 4KHSA 2LPMA 3NE6A 3LDSA 1RXEA 3GBVA 4NH6A 1QSSA 5KRTA 3CM5A 4DTMA 1RT1A 3QX9A 4WE1A 4AHVA 2G8KA 4KAZA 3HZHA 3I5AA 4HUEA 4FE4A 3K58A 3CG0A 3KKEA 3HL8A 3M9XA 1S9EA 4B9SA 1DBWA 1NJZA 1SKRA 1Z15A 3F6PA 5J2NA 2FFLA 3KKSA 4Z4EA 3RVMA 2OPPA 3HP6A 3KYJB 1WETA 4TLLB 3QO9A 4ELVA 5TQ0B 1WSFA 1NOZA 1ASUA 2G8UA 2VWJA 1CLQA 3H1FA 4KZKA 4Y1DA 3ZSQA 5CNMA 4F8JA 3ZT4A 1YMVA 3ROTA 1WN7A 3LUKA 3ITHA 3H6GA 4D6YA 3HPOA 4ETNA 3O75A 4KI6A 3OMWA 9ABPA 4DF4A 1NATA 4CJWA 4H60A 1GLGA 1PHRA 3DM2A 3H6HA 3VA3A 1NTRA 3AVAA 3QK7A 4RZSA 5I4CA 1XI1A 1HNIA 3V9XA 2AYXA 4FW2A 3NFAA 1E2BA 4ID5A 3HSTB 3ZSYA 4BE0A 3MJ0A 3KLGA 3EJWA 4ZYLA 2HMIA 2XDYA 3OLZA 1SV5A 1D1QA 5E3JA 1EHCA 6ABPA 1D5AA 2A1SA 1CHNA 3M8RA 4DTSA 3V1QA 5HRRA 2Z1HA 1U49A 1M2EA 4AHCA 5CHYA 3SG0A 2DY4A 1APBA 3SUOA 1C1BA 4N0PA 4YGXB 5TQ2B 4CJQA 1HNVA 2P5GA 3OS2A 4D74A 3HCWA 1QTMA 1C0EA 3F73A 1JDPA 2PE5A 4LSNA 3O4QA 4O1IA 4XIUA 1ZH2A 4FJNA 2KW4A 4GW6A 4H4MA 3IP6A 3VQDA 4KHQA 1LJUA 2LP4Y 2F8SA 4L8RB 4KREA 2WWVD 3CFYA 3BGRA 2RGYA 3IPAA 2HSGA 4ZPJA 1UWBA 2PUCA 4ZMRA 3NGYA 2J48A 1JLAA 2A9OA 4E1MA 1DC7A 1X9WA 2DTUA 3TR8A 4CHZA 3SY8A 2XFMA 1FQWA 1AB6A 2BDPA 2ATQA 3OQMA 1FSPA 4PE5B 1KSPA 2E4VA 1ZITA 4IG0A 1L3VA 1LBHA 3QETA 4PUOA 4MRMA 2P1JA 2HVIA 4OLBA 1U0SY 2DRIA 4KI4A 2ZQBA 1VSKA 2VG7A 3URMA 3RMDA 4DU1A 2YV0X 3U6FA 4FJMA 3JVDA 4PY5A 4QOZB 4MS1B 1RTHA 3VQAA 3HM9A 2HB5A 4YO7A 4M3XA 4W5RA 3PO4A 1RT4A 1ZGZA 1MVOA 4EYOA 4PYRA 4RK0A 4XAQA 5FRMA 3V9ZA 3IS9A 4RW8A 2BANA 3Q9SA 1ISSA 4MR7A 1EKEA 3KJVA 2AYZA 1XHXA 4MR9A 4JA2A 3LWMA 2BE2A 3GBPA 1LWFA 4O4GA 3RH0A 3EAFA 1TL3A 4FK2A 3DYAA 1HYSA 4RKQA 2CHFA 2JVJA 5KQPA 3K59A 1BI4B 4OKKA 1USKA 4HTUA 3P83D 4FZXC 4Z4CA 1U8TA 3N0XA 2L19A 4B9LA 4FLZA 2RKIA 1QE1A 2FMIA 2LIVA 4DTOA 2A9RA 3DGFC 1RT5A 4ETIA 4HNRA 1D8YA 3TAGA 2FBYA 3WNHA 5T3YA 5IUKC 4Z4HA 5TPZD 1YIOA 1A5XA 2L5DA 4CE9A 1T7PA 3Q7TA 5ED4A 4AILC 1FFGA 4NGBA 1A2OA 3ZSXA 2X6NA 4KO0A 3LMKA 3O4NA 1JX6A 3H1EA 3EODA 5SZTA 4N0QA 3QEWA 1I3AA 2XY5A 2PYJA 5IUNC 1BVHA 3M8QA 1W25A 4O0IA 5C5EA 3QIOA 1Q8IA 1NK6A 1XC9A 4YS6A 3BBLA 3DLRA 4BDYA 4YP9A 4OPJA 3C3KA 1SXHA 4KHWA 1QP0A 4F06A 3K5MA 3O1HB 4MAAA 2XY8A 1KFDA 3QEKA 4RK4A 1NK7A 4EVSA 4LDZA 1KGSA 1ISRA 4FVMA 3QIRA 1PEYA 4HCBA 4TN5A 4LSLA 4UHJA 1NKCA 1TMYA 1YMUA 1TGOA 3AVBA 4D6XA 3L2QA 2PJUA 3V9WA 1A5WA 3VN5A 4FJGA 4FJIA 2QKBA 3KJXA 3NCIA 3OM0A 3K5LA 4WUTA 3O7VX 5IEBA 5IX8A 2FBTA 3JVIA 4F4KA 2FEWB 4MYRA 3HPHA 3RRHA 4E19A 5KC9A 1JLQA 1HYVA 3LP1A 2ID9A 2PL1A 3KHTA 4QICA 3T95A 4OPKA 1ABFA 4IDKA 3WNGA 4LRQA 4M3WA 2OENG 3T8YA 1S1WA 5CZ1A 3L3UA 4N56A 3G10A 5B3JA 4K8ZA 4KKOA 4CFAA 1BIUA 2QXYA 2B4JA 2JBAB 3OYIA 3RR8A 3KLNA 4DG1A 4CJFA 4H3HB 5TQ0A 4G97A 4RU1A 4O5AA 4FZZA 2G8FA 2L2QA 2WY2D 4CIFA 2QU7A 2HNZA 1RT6A 2IPMA 4O1HA 1Z12A 3TABA 3KYIB 4DU3A 1VLZA 4YLEA 4LY7A 5EWLA 4PICA 3HJFA 1U47A 4CFBA 4FZYA 3OY9A 1RBRA 3T3FA 3PV8A 5T7BA 1UA0A 5TQJA 4MS3A 4JAVC 3EY1A 5D3GA 2GV9A 1X9MA 1DJMA 3SPZA 2YNFA 2M98A 3K9CA 2E4LA 1M5UA 4CHYA 3I45A 4FJ5A 3FFWA 1VYNA 3VA0A 4B9NA 4M88A 3H1GA 1XHEA 4E3SA 2OQRA 5KTQA 3DLHA 3SUNA 3D02A 3OVNA 4ZHRA 2KFNA 3M6MD 1PNRA 1NXXA 2HHTA 1ASVA 4G0OA 5TQ2A 2R7YA 3HV2A 4DQRA 1RTIA 1RBVA 2FMFA 2D5RA 1PNTA 4FK0A 1ZAYA 4B09A 1R6ZA 2JGUA 1VPWA 4FCYA 5KGWA 3JYTA 3HSYA 1KLNA 1KVBA 4E7OA 2Q5CA 3OO1A 4DSEA 1KVAA 2P9HA 4C8NA 3OS0A 1I39A 3A0RB 1DBPA 2JLEA 3CKMA 4N5SA 2HNYA 2WJAA 2KZZA 1BAPA 1ZBIA 3MEEA 4OKEA 4LX8A 2IDOA 4B08A 3ROFA 4B3OA 2B4AA 3IP9A 3JY6A 3SZ2A 2KTQA 3O2JA 3S3MA 2IS3A 3QEIA 3HT3A 1ZVVA 1RTJA 4FJ8A 3H5OA 3LAMA 1ASWA 1WAJA 3L49A 4DQDA 1BDHA 3TD9A 3G1WA 4DQPA 5HM6A 4CJTA 3WNEA 3SM9A 4FJHA 1C1AA 2MYNA 4FJKA 3VQQA 4DSFA 4WZZA 1URPA 3I42A 2DFEA 4EY3A 3LUAA 4UHKA 4CIGA 4ZMSA 4H4OA 2RF2A 1EETA 4DSJA 3AV9A 1TKDA 4FE7A 2NUBA 3LUDA 1NJXA 4MS1A 1T34A 3OS1A 3MXIA 3NGIA 1QO0A 3C97A 2VUHB 1IO2A 4S05A 1VSIA 5HKOA 2WRZA 2QK9A 2E6MA 3C6UA 4EVQA 4JS4A 1F51E 4OBBA 4ICLA 2D0BA 1AB5A 3HYFA 3W9SA 3QELA 3AA2A 1GUDA 3LUJA 2FN8A 4P98A 1BI4A 3NF6A 2XY6A 4RK5A 4EVRA 1RXIA 2ID7A 3MEGA 3OYHA 4B8CA 1NJWA 2KYRA 1DBQA 3AA3A 1BDIA 3C3WA 2FC0A 3SAJA 2YNGA 3RQIA 1VRUA 3K5NA 1IKVA 1LK0A 3SV4A 3ZSWA 1JDNA 4DTPA 3QEMB 5DTEA 3TB6A 1SUQA 4NCGA 5BR1A 4YRZA 1KVCA 5DCLA 2FBXA 1JBEA 4Q6WA 4LE0A 3OLVA 2HW3A 4CF0A 4Z0NA 3H5IA 3T38A 4AHSA 2IPNA 5C42A 4WT7A 3T19A 2FMKA 3FFTA 4E7KA 2HHWA 2JB9A 3A2FA 3KD5E 4DSKA 4E7HA 3MYYA 4OTZA 3TX6A 3I09A 1HJRA 2X6SA 3ILHA 5FWYB 3RVSA 4IKFA 1QHTA 3C95A 3FDFA 1PUXA 1QSYA 3RVOA 3HVTA 4Z99A 3LUCA 3K5OA 3KTQA 2QR3A 1CYEA 3EDCA 1ZESA 3P9YA 5EWLB 3SQ0A 4CGGA 3AVNA 3L2VA 1NY5A 3LANA 5J2QA 1RDDA 1EAYA 2QV0A 4R5PA 2X7XA 1JFSA 4BE2A 4E7PA 4EP4A 1S6QA 1RTDA 1JLKA 3F7NA 1JLBA 1DRJA 4MS3B 4FJ7A 1WNSA 2RJNA 1UOCA 4QYMA 5KQMA 3MIZA 1RDCA 3KLIA 5CYQA 2RN2A 4DFKA 4JLHA 1ZY2A 4RXMA 1VRVA 3THVA 1P6UA 3VQPA 5J2MA 4H8KA 3ILYA 1SKWA 4ELTA 1DC8A 3B2NA 5SWMA 5JNVA 1PEAA 5BRJA 3TWHA 3QX8A 1TK0A 1EFAA 1YS6A 1JL2A 4DTXA 3C6QA 4IG3A 1KMIY 2HQOA 3VQBA 3LFTA 4F11A 3GWGA 3IP5A 3RVQA 3H5TA 3NBMA 3AVFA 4F3TA 1JL1A 3ZSZA 1BA2A 4DTNA 1JLCA 1TAUA 3QNOA 1U04A 2VG5A 2JBAA 1QPZA 3DOKA 2HHUA 3N0RA 1WLJA 3L2RA 4FM2A 1HPZA 3RTVA 3E61A 2IC3A 1G15A 3QLTA 3D8UA 5ABPA 4HVJA 1RILA 2HHSA 1LWEA 3LUGA 4DSLA 4Z9AA 3VQ8A 4RWEA 5C24A 1QO0D 4DFJA 1Q9YA 3PO5A 4N47A 5IC5A 2D0AA 3OMXA 3NHMA 2E4UA 3ZSOA
chains in the Genus database with same CATH superfamily
2H4HA 3ONVA 2XOKD 5DSXA 5AMXA 1ZOSA 4ZI5A 1Z38A 5DV9A 3NKFA 4RLFA 2W8BA 2PZLA 1ZM9A 3STYA 2FY8A 2YQ5A 4JP8A 1EESA 2VATA 3ABQB 4DV2B 3OYLA 2DTEA 3KBOA 1FZQA 4AHTA 1P90A 2YWBA 4HCCA 2HBRA 5LZ4A 1PSWA 1U11A 3BB4A 2J41A 3P26A 4I5DA 4UNPA 3VPCA 2AMFA 2WHXA 4DQQA 4MQ3A 4KV7A 5F64A 1W9HA 3QFCA 3PX7A 4NGFA 1HKHA 1LV5A 2XY7A 3S2IA 2ZRBA 1NR7A 4C2BA 2C3UA 4DLZA 3EYZA 4GO1A 3DSRA 1YL6A 5LJWA 1K4KA 4L51A 4H7FA 4C9BA 3E01A 3NAQA 4GLFA 4CGIA 1X8JA 1CEQA 1OKKA 3B60A 1D7AA 3RYIB 5DNYB 5CJJA 2JAPA 3TWOA 3VR5H 5AQIA 1NVWQ 3KTDA 1U8EA 3UMBA 3QVUA 1HPLA 1W44A 2BKEA 1RWQA 5AHOA 2JVIA 3P39A 4MDFA 3R44A 1Y3IA 2IOCA 2M2IA 5A5FA 2NO5A 1WABA 2BR5A 1YJQA 3D8NA 3VKGA 4XVUA 3FPAA 3SIPA 4KQ1A 4OPHA 4YNQA 1E69A 3DEZA 4JU8A 2PKCA 5DNVA 4P4NA 4DLGA 4NCIA 5DWVA 2EJUA 3D4IA 3CVXA 2XITA 4CEAA 5ALIA 3TECE 5LVAA 3LIPA 1F6WA 3WAGA 3OO0A 1CJUC 4DVGA 2V7VA 4P81A 4XWGA 1N7HA 2RG1A 1MRNA 4CMAA 4HNSA 5JOQA 1ESMA 1ES9A 1YE8A 3DQZA 1QHAA 4ILKA 3U4MA 2XB6A 2IE0A 5FBRB 2PJZA 1UFRA 1KFCB 4URHA 4YRMA 4TTTS 5EU7A 4W63A 5IDXA 2OBMA 4UTZA 2EFCB 4INAA 2JFOA 4MVCA 3EY9A 3WNDA 4AQDA 3BKWA 1I5EA 5IVPA 3LLVA 1NHWA 3BDIA 4QCLA 4BNDA 1T4MA 4GR9A 3K31A 4NV0A 2Y1EA 1KWGA 2DFNA 1RNLA 5K0NA 4GRDA 1W5EA 3EL2A 1TF7A 4BEBA 1VKNA 3N2ZB 5ES3A 4ZT5A 1O4WA 3FFAA 4CMGA 3P5SA 3LCRA 3QVLA 1L8LA 2Q2VA 1XQSC 4ERNA 4D8YA 4IZHA 1AKYA 1V41E 4DM7A 3P9QA 1ZD4A 3EQ7A 2DCUA 1XXHA 1P17A 2ZI3A 2J7KA 4KK3A 1WW8A 2OLJA 3S68A 1GM5A 3QU7A 1B8VA 5MDHA 5FIUA 4FJXA 3A58B 2FF3B 3R5KA 1TNDA 2ID8A 2R6R1 5EHZA 3OLCX 1QK3A 5DPMA 3T1QA 3BIJA 3NBYC 5GJBA 3VR3A 3TSPA 3PNPA 4AWXA 1OZ0A 4DJAA 2H00A 3Q72A 4K0RA 1GN9A 2XBUA 4IO8A 4E94A 2R68A 5CP8A 1PK7A 3RS3A 2QRMA 4CG2A 3D0KA 4ZT2A 2CLOB 2QJRA 1GA1A 1XZGA 2HK7A 4QSHA 3BWMA 1XL0A 5FHQA 1RFQA 1AZWA 1ODJA 5K4GA 2PT7A 3M8PA 4BRQA 4X60A 4Y9TA 2WT8A 4BV2A 3CXRA 4G41A 5FPSA 3SN6A 4DJDC 5H9WA 1HT0A 4KLAA 3ZE6A 4FFMA 3QNNA 4NV1A 5EMKA 4HMQA 1TYEB 4JOQA 4HY3A 2CF6A 1BXGA 5HNKA 2PUDA 3CZPA 4R41A 4I6MA 1T2EA 3SQWA 4KQ6A 2I76A 3N2EA 1JKJA 2FOXA 3CH7A 2XNDA 2P11A 4LYJA 3L6QA 5L45A 2D2VA 5EXPA 3AR2A 1LLQA 1WB9A 1H6BA 3KEQA 3GV0A 4ZAYA 3K32A 1L5RA 3C0BA 4UTVA 1NL3A 2G8NA 2X78A 4JK7A 3JSXA 2VCPA 3EDYA 4DCSA 1QE5A 3FDZB 3H2KA 2UUAB 3PU6A 4N0EA 2IYYA 4YLGA 3EB9A 2B6NA 1KXJA 3QXGA 1CIVA 1VHJA 1XP5A 1LPMA 2CFCA 3HYSA 5M1NA 1N92A 2YJEA 4NP6A 2XTJA 2Z5FA 1BXKA 4J2AA 4Q18A 2XWJI 1FSGA 4RIIA 3EN9A 1XRRA 5F1KA 4MV0A 4TUYA 3K0HA 3VKWA 2YR0A 3U9SA 4UHCA 5E6SB 1CRWG 3JXUA 3TR0A 2H06A 2UZ4A 4BBAA 3LUHA 1C7JA 1QYIA 2KBFA 5BW8A 5EIWA 5AVZA 4UQPA 1K92A 3I34X 4CG1A 2C5AA 3D7LA 5ENDA 3MB5A 5JNWA 3EVDA 4TL8A 1NQOA 1GTJ1 1EUCB 1SVKA 3BJMA 5EZYA 4Z8YA 4CIBA 2QXFA 5EYPA 3V9AA 4DPMA 2PJDA 4RK7A 4U4AA 1IPFA 3N2GB 3VAYA 2FR8A 4ZJZA 1XZMA 2JCXA 1PP4A 3L8CA 1T36B 5ECYA 3AJ8A 1WUIS 3FZKA 3EW7A 5AJHA 1YF3A 2IIRA 3R5JA 3VYRB 4KQ2A 2ANBA 4DQKA 4JEMA 1SHKA 3L7AA 3B1ZA 2AX4A 1JR2A 5ITZB 2ATCA 2H4WA 2VJNA 1BS2A 3DBOB 4JP2A 4WZAA 1XZDA 4FDUA 1SKYE 1S1UA 1E6LA 3U3XA 3E0XA 4DS4A 5C0YA 5J2TA 1SXJB 1LPPA 1JLFA 2B4RO 2O05A 3I8DA 4JU9A 4DQIA 4GX2A 4IYJA 2OC9A 1RWKA 1R16A 4RVDA 1XPOA 3WI7A 1E3LA 3ACCA 4B83A 2ZBPA 3A3KA 1DXOA 2HA0A 1XVAA 2WNSA 4ER5A 4I4LA 1XZCA 1MV8A 1YR3A 1C8BA 1LBSA 1KNQA 3VU8A 1CDZA 4A0SA 3TCXB 3P5BA 4IOXA 1T3HA 1CE8A 5JZMA 5I8WA 4A6PA 2BFCB 4RSHA 1ZP6A 3RASA 4B79A 1FKPA 4Q02A 2AC2A 3MMZA 3ZTYA 4H3SA 4O8UA 2ECFA 1KFSA 1NVGA 1OI4A 4OIFA 5DVZA 1GL7A 1LB1B 1Z26A 2HREA 1UXKA 5C5CA 2Q9AA 2Q6LA 4G4JA 5CX1A 4B4DA 4Y6GB 3H0KA 2BGRA 2EHJA 4I19A 5T4HA 4KXXA 5JZOA 4COKA 2ES4A 2X13A 3DOEA 1RZ3A 2ZJQL 1XGKA 4X6YA 2QVWA 2W6QA 4DUYK 5GTDA 4K9OA 4NGGA 1X1CA 3ES9A 1TT5B 1O9HA 3QXJA 5BNZA 5ALFA 3PDCA 3N8GA 4J2EA 4EB6A 3FMGA 4P93A 2I3BA 1GG5A 3HWSA 4C2AA 2CLHB 3LL7A 4X62B 4XUEA 3ONFA 4YXWA 4QOEA 1HLFA 4NF2A 1CXUA 4GQIA 4RL4A 4DG9A 1TEVA 1R0ZA 5EZQA 1VQ5N 2PMCA 3MT9A 2GQ0A 3P4IA 5BNIA 1DKUA 4CGHA 4MK4A 1EWRA 1U3GA 3LUPA 3AO4A 2R1VB 5JNSA 3LO8A 1ZZEA 3F97A 5TVKA 2O0LA 1W0HA 2HIHA 1UPXA 1HQYE 4IGFA 4FFPA 1CHDA 4Q7LA 4C05A 3T1OA 4JBNA 4NPHA 3WNVA 5TGZA 4EG8A 4NIMA 4OREX 3VEOA 3MWPA 4EGQA 4UBNA 4MQ4A 1R6BX 4V0MA 4QUBA 3LQ2A 3V8VA 4F5ZA 4YOYA 1VMDA 3A6GA 3GT0A 4PSAA 5ALGA 3GG4A 2Z3ZA 4A0RA 2YICA 3M1FA 5JATA 3N6VA 4EFLA 2OVFA 1U02A 5T57A 1PKXA 4DDTA 4ROTA 2KE5A 3ZV3A 3K4QA 4P4SB 2AKYA 2QL9A 2Z3WA 3NAEA 4EJSA 2I0FA 1S6PA 5ENZA 3FNEA 2FPMA 2E9SA 1JPVA 821PA 2B83A 2FLVA 4LNUA 1HPMA 4OBXA 2GKSA 4FCVA 4CDNA 2CDNA 4HUFA 1UPAA 2J3IA 4CL8A 2VP3A 1I4EB 4PQFA 2BJWA 4H1VA 4DLPA 3IV6A 3AA5X 3L7BA 1XCBA 4HB0A 3N2KB 1PT7A 1VP9A 2ZF5O 3ZHCA 4A8HA 2XYVA 1QZ3A 5KB3A 1MAWA 5DKFA 3E82A 2ZR8A 3U7GA 1NJGA 4KNVA 4R7GA 1CFZA 1EKXA 1AHHA 1P29A 3BD9A 3S8EA 1MB9A 4GLBA 1Z0ZA 4YRPA 3OT4A 1CKEA 3P0RA 3DAWA 4LK2A 4U39A 1TTQB 2XRIA 3WMRA 3EIFA 4CHOA 2HHXA 1K5DA 5M1OA 2PGDA 4IHJA 2PU5A 2Q3CA 1KYYA 5BQOA 4ZU6X 1BMDA 1BH6A 3N9IA 3B12A 1J33A 2B2NA 2PBRA 3DOJA 4WRRA 1IRIA 2W6LA 4AULA 4S12A 4B40A 4EG6A 4MINA 2Y1WA 4M38A 2H0QA 3LQKA 4UEJA 2JJ8A 1Z25A 3IDAA 2FR0A 4W6ZA 4J43A 1CDOA 4MV7A 1ZD1A 1Q77A 3EQ6A 2QGFA 2QG6A 2WK1A 1TX4B 3K58A 3HXOA 3QXHA 8OHMA 3BKXA 4B9SA 4AN0A 3HJRA 1R66A 3ZX2A 4OL9A 3KKSA 3ORYA 3LT4A 1AKEA 4RVUA 4F72A 3G0CA 4RF4A 3FPEA 4YPOA 5D3MA 4YJDA 2PAAA 1UCFA 3R1IA 5KSWB 2J3MA 1NZDA 4L3QA 4Q82A 4H6WA 3QTTA 3O75A 2YNMA 2J9YB 3OMWA 2E87A 9ABPA 3WK6A 3KXLA 4MYHA 2ZJAA 1NULA 1A9XB 3ODPA 4A26A 1PHRA 1C1DA 3MN7A 1QH1B 2PHZA 4DVJA 3AK4A 2Y27A 4LDPA 3LQQA 2ONJA 4RLQA 5KQSA 3D1LA 5D85A 2XYPA 4XTRA 4YNBA 4NE9A 2V4ZA 3O3OB 1APBA 3F2VA 4P35A 3NPAA 3ZGXA 2QQEA 4N39A 2D06A 1GTG1 1CVLA 3KQLA 3FF1A 4JI4B 1VQON 3LY9A 4ZO9A 3IA7A 2ATXA 2A59A 3GMIA 4GNKA 4MGZR 4QXPA 3KU1A 1MJHA 5HDQA 3NMUA 3F6SA 3PXXA 2BRUC 1F48A 1N3YA 4YMUA 3DO5A 1IDN1 4QHYA 1SCUA 3WQHA 3OQMA 4IDDA 5A04A 1NURA 5B55A 4MIOA 4EJ6A 5D1NA 2UYYA 4JK3A 1XELA 3CLUC 2Q1WA 2XNSA 2D5IA 2HA2A 2ICAA 1T0JB 3IAAA 5BT9A 2C3YA 1KQSM 4KQMA 3PO4A 4RACA 5K0EA 4R16A 4LY6A 3ZWDA 1Y1RA 3I64A 3MT7A 4YJHB 2FEXA 3COSA 1XHXA 4PYOA 4BNJA 4UDYX 1QWOA 3W2HA 2C2ZA 3RFCA 3HSSA 1PW7A 3KZOA 4UKDA 4FZXC 1QYVA 1E9FA 3FMIA 3UFXA 3D2FB 1IG3A 4B9LA 1CDDA 2PFGA 2ILTA 1KI1A 5EFZA 4GAEA 1RYBA 5KYWB 5DBOA 5FBWB 3OY2A 1ACLA 4G9GA 4XH4A 3VOTA 3SYLA 1LDMA 4ZVUA 3PNVA 3RFFA 1FFGA 3CKKA 4H27A 3RUDA 2G3YA 5JD4A 4BAUA 1HQCA 5SYNA 4TYWA 2XDWA 2BHSA 2BZ1A 1SUFA 3E35A 3TOVA 4B3MK 1DQNA 1CV2A 1PJ2A 3OQIA 4RTOA 4RKWA 3C16C 4YHHB 2GXSA 2CJFA 4F06A 2FPPB 5K8JB 2RK3A 5KKAA 2HV8A 4U02A 3DFKA 5JWOA 3JQGB 3WYCA 1YCDA 5CJPA 3UO8B 3CEPB 4ES6A 4CE6A 3QJ5A 3FHTA 4PFQA 4J1TA 3I62A 1CTQA 4G5FA 1KY4A 3IQIX 1A71A 3V2UA 4DUGA 3HGMA 3O7VX 3KVNA 1X7XB 3P52A 6LDHA 3PWZA 2FEWB 1GZ3A 2PGOA 4AZTA 3UN1A 3W5IA 4WQ5A 2HHHB 5AXCA 4IKOA 1A4UA 5LOVF 1LCUA 2GX9A 3EGXA 4D46A 2Y6UA 1ABFA 1KTIA 1VSTA 1S1WA 4N56A 3N5KA 2VJMA 4CJFA 2Q6KA 3GNSA 2WSLA 1K97A 4ABYA 4MKXA 3HUEA 3W7AA 2WA2A 3HP1A 5K7SA 1N36B 4JJEA 1M8FA 4OI2A 2AHOA 4BR4A 1VJTA 3ZDDA 4JXJA 2OYSA 3HJFA 5JLHA 3OOEA 3D54D 1NJ1A 4YUZA 2V97A 1B16A 4F9TA 3QBDA 2IH4A 5B8HA 1DJMA 3P71T 4CV0A 3T0FA 4EPVA 121PA 4U2BA 1JA1A 1POWA 4D44A 4GYJA 2EQAA 1XEXA 5MN4A 2XCQA 5AK3A 4N5HX 4PX2A 4FYPA 1OWOA 4ZDIA 3K9LA 5FPEA 3UGKA 1PNRA 5GONB 1ASVA 2ZAIA 4RH1A 4X9XA 5B1HA 3P0JA 2OFOA 1ZC6A 3HV2A 4KO8A 3IIEA 2H8KA 4KW7A 5TMEA 4REQB 3EMBA 3TN7A 4A6DA 3E7WA 4QAJA 1EQAA 1XTVA 4S1OA 2HMPA 2XXAB 2GWKA 3VGKA 8GPBA 1DBPA 1YCHA 4N7BA 1Y8ZA 1UPFA 3WGUA 2G4CA 2I3AA 2I87A 2B4AA 1BDBA 5BN4A 3BD6A 1RTJA 3H5OA 3JATB 1ATZA 3LVQE 3K3PA 4HWOA 1J42A 1FNCA 2G08A 5KPZA 3OZEA 1T8WA 1RQGA 1UH5A 3ZYCA 4KFRA 4H1HA 4BEVA 1P44A 4CGZA 3JX9A 1NYQA 3WK9A 1WXEA 4ZO7A 1QYCA 2N47A 1N36K 5CVJA 3C6UA 4GWLA 4NENB 3G82C 3BMNA 3W9SA 1ZX1A 5E26A 5JG7A 4QBFA 4LQDA 5BV8A 4MRRA 3TEJA 5TF0A 1NJWA 4M1ZA 1FK8A 1PWHA 3SAJA 4MKGA 3STXA 2P77A 4WKGA 1HSOA 3ZE8A 2B35A 4BC0A 3SV4A 3EH1A 1QHHA 5BR1A 5JY6A 5AQPA 1KVCA 3JZMA 1QANA 1DJQA 4YI5A 3T38A 3QQ5A 5BOSB 3CSDA 3OETA 3NEJA 2X9QA 2ZGVA 2IYPA 1D5CA 1W8IA 2R86A 2WOOA 3C8MA 3VSEA 3DBHB 3GNQA 2QY9A 3EG9B 3EIQA 1HDGO 2EWWA 1HFEL 1L2TA 1XK6A 4DILA 2X0NA 1ZLYA 3ST7A 2X7XA 3D7KA 3UJAA 2JH3A 5TDHA 2OMKA 4NJEB 4NEHB 3DZCA 4PQYA 1WSWA 3JRXA 1XCLA 1VRVA 2JH8A 4KX3A 2HJVA 4OXIA 1ZISA 1OZHA 3OP1A 1EJ0A 3B2NA 2I7NA 5SWMA 3OHRA 5CA0B 5G02A 4JJAA 3HNPA 1JL2A 4DABA 4OYLA 1N4AA 1D03A 5AW5A 4HDCA 3UWSA 3IP5A 3RVQA 3A9RA 2ZGZA 1NVMB 4U3JB 3ZHTA 3AVFA 3DTVD 1Y80A 2OHOA 1TKCA 1HLGA 1PZEA 1SFRA 3MJHA 3PNKA 1IBLB 3C14C 2V3VA 5GIOA 5BPHA 2R1TB 3NS7A 2ZIUB 2HHCA 3U16A 3GJXC 2IUUA 3E4DA 3DJFA 4I1PA 2VWPA 2NRRA 3MTGA 1M0TA 3QWFA 3PUXA 3K7EA 1RM4A 3B9QA 4NAVA 1N9KA 4JKAA 2VPIA 4DR5B 4QBGB 3JWHA 3WKAA 4ODIA 1VL1A 4B2PA 2OO5A 3I05A 3KB2A 4FWQA 4X3PA 2KX7A 3BQMB 4K03A 1WEKA 2DHCA 1USUA 5DI9A 1Y5LA 3RFVA 3OE1A 2WT4A 5HJ7A 2YHSA 2NT4A 4YT5A 3BPSA 1JAYA 5KKCA 3HM2A 5A6SB 2I03A 2QTBA 3LC7O 3U5ZB 2ZBVA 4EP1A 4I50A 2ZE6A 4JKGB 3NVMB 2WQZA 3IILA 1G21B 3OT1A 2HTEA 4WEQA 5FCDA 5HF9A 3KOXA 2PY5A 1UJMA 2CJYA 2HUPA 5J9FA 2N1BA 3GLQA 4P80A 1SI3A 2RHMA 1W5AA 3S0JA 1Y3HA 1Y3AA 2AH5A 5E38A 1TK8A 4J07A 2I7XA 2IUYA 2I1VB 1KE1A 3EG5A 2BFFA 1BTOA 4EYGA 2OB1A 2EZ8A 4CQMD 4MA4A 5IT9O 3ZVLA 4IJNA 2C2BA 1KKLA 3TTVA 1CJMA 2BKVA 3IAM6 1Y8RA 3JCZA 1Z6ZA 3SGLA 2JRCA 2R84A 1WULS 2P6UA 1DAMA 3DMTA 3UWPA 3MQFA 2WTUA 2GPTA 4E3ZA 3L8FA 3W6PA 1ADFA 4XYBA 1U63A 1LRLA 2WAAA 4J3JA 1UM9A 3DVLA 1GOCA 3IOBA 3G9QA 1JLSA 3HA5A 4I36A 5ICCA 5HQJA 1Z0AA 2Y0BA 5BW5A 2GRAA 2P9FA 2AI3A 5FWAA 2H07A 3NHZA 5KQLA 4BE7B 1XDUA 3B82A 2OB2A 2XKAA 4EI2A 3H11B 4EFDA 2OCDA 3BF8A 3OPYA 3R0IA 3MGBA 3W79A 1J22A 1P1CA 1EVZA 4LF5K 2YN0A 4DCCA 5FWYA 4RVSA 1Z16A 1IZ0A 5H7XA 4DQXA 3C0KA 1GLBG 2VWGA 5CLHA 1JYEA 3BQ9A 2Q0UA 2RC5A 5EP1A 1QMPA 4BVEA 1Z5NA 2N46A 2RI6A 4A03A 3S9HA 4GQAA 1B3RA 2HQ1A 4MLCA 5D6OA 1ZGBA 2HHLA 4W1RA 2LSNA 4HNVA 4BO6A 2VO1A 4M1KA 1JKMA 3EZWA 3L2UA 3C74A 1RU3A 4B6QA 1U9IA 1V9SA 4D0GA 4JI3B 4JI8K 3MF4A 1AQ6A 3RYCA 4A1FA 3NHFA 4FLUA 3SX0A 1JSXA 2AP1A 4DPLA 4Q48A 4LF7B 3AO3A 3X3HA 5JJIA 1XMVA 3SWWA 4OAQA 4US2R 2PA3A 3I55N 3GPCA 3ZKWA 2J67A 1P0MA 5BV1A 1U2RA 3IX7A 4HVCA 2YV1A 5BWBA 3CPSA 4JB0A 3WGIA 3UK7A 3WOVA 2JA1A 3TAMA 5C1BA 1Z29A 4EPYA 4BNFA 1KO4A 2V59A 2QTRA 3O8DA 3TZBA 3O4JA 3RV4A 2FZWA 3EX7C 4ZYZA 1LJLA 3CQ8A 4KFCA 1LC0A 1WUAA 4L0MA 1S2OA 3I72A 4KWHA 4H4DA 4DBLE 1H1VA 2R48A 3ZCSA 1T9KA 4PBRA 3O2NA 2OM6A 3UBMA 2C2MA 3E5HA 3TSUA 2QTNA 4KFBA 3UHFA 2CBZA 3UAWA 4KQGA 1SRRA 5HWSA 3K30A 4ZEMA 2ZLBA 1QGED 2DU8A 4JXKA 3QUTA 1UZMA 1X7ZA 5HQ3B 4BR9A 3OBYA 4YMIA 1MU2A 4L57A 3ZX5A 4CJ7A 2GYUA 4N8SA 4B81A 2VDVE 3KL4A 4OKJA 4C7JA 1GPKA 3Q0EA 3QKRB 4KHYA 4TN1A 1TUBA 4LF7K 1W4AA 1YXMA 2ACKA 3U4QB 2H54A 5F33A 4WPGA 1L3BA 4RCVA 4RTQA 1T4CB 4EG0A 4J4BA 4NJMB 4Y8VA 3ZV5A 2OGTA 1Z68A 1N5JA 2GA9A 2RJOA 2WF5A 1AGYA 4MCJA 1BQNA 1EFVA 2K4MA 3S1AB 3PKIA 3UXYA 2NP7A 3ZWQA 1U2EA 4BB6A 1J2TA 4JL8A 3SJHA 2D2XA 1KS2A 2BI4A 5DX1A 3JRNA 2WM8A 1NRIA 5ECWA 2ZT7A 1N1EA 4W5OA 4GICA 3TFQA 3N8IA 1RLIA 4C3OB 4D4JA 1SG6A 2BKXA 2OK8A 2LIPA 3FPKA 1AXRA 1O94D 3CRNA 3Q3CA 5SZHB 3KB8A 1Z2AA 4O44A 3UH0A 4JHLA 1MZPA 3DAGA 4D41A 4LSGA 3STTA 4ZI7A 5KMGB 3KR2A 3FIUA 4RD6A 2FF7A 1O54A 5MF6A 3GT4A 3Q3VA 1IEXA 1YNSA 4LHVA 2JZCA 3GZNB 3VSDA 4M0MA 2VIIA 1YF5L 1KMCA 3U31A 1P5HA 2BCGY 3RW9A 4AY4A 2AYYA 5FWXA 4MWTA 1R6DA 1VCOA 3AFMA 2NO0A 1TKTA 1E58A 1P2FA 1U1EA 3KEFA 2ASPA 1U48A 2PLAA 3HYNA 3LLSA 3LBNA 4B7UA 1G6KA 2A9PA 2OD9A 3OTQA 5ADXA 1BMFD 4IIFA 1YVPA 4B6PA 1PG2A 4Y2RA 5EUCA 3TNYA 3WGVA 1ESNA 5TPWA 1OLUA 1FBNA 2G80A 3ENBA 1BCRB 2VT6A 3Q7QA 4RW4A 1T91A 3T9CA 3TAHA 4AJ1A 3MX2A 3H87A 1XJQA 4ZYUA 3IMFA 3T1YK 2BGGA 3RGWS 1CF2O 4ZTFA 2AG0A 1VSEA 5CVDA 5JMVA 2JRLA 5ADVA 4HP8A 3O2QB 1VM6A 2CVHA 1E79D 4YIKA 2RIPA 3U3KA 3QVOA 4ZV7A 5BP7A 3AONB 3EQ2A 4TLDA 5FNVF 5LU8A 4LSWA 2J7PD 2QZJA 1E59A 2C2KA 4MYDA 1XZBA 4IVNA 2KPOA 4XIGS 1HRDA 3KFLA 3SICE 1X1SA 3TQOA 3ASMA 4OQNA 3UJ7A 4M3UA 3ZWXA 1NGCA 4X84A 4WCFC 4MS4A 1EFHA 2HXSA 1T2AA 2FOIA 1O2DA 5AKEA 1Y4ZA 2WLSA 2QZZA 1MG5A 4EM6A 3U9LA 4X7MA 4DR6K 5GM2A 3W5CA 3DXMB 1FFYA 5M5BA 2BGWA 3ZDFA 2Q5IA 3B51X 4RH3A 1LF5A 3UVEA 5FTLA 2DFKB 5LJIA 4EPTA 4RA6B 1BH2A 4X1OA 3TLMA 2JI9A 1KBQA 1OE0A 3MJCA 4C8MA 3JQ6A 5FTJA 3IVCA 1T1EA 2FDXA 4CXMA 3TTDA 4CF9A 1W1UA 1EFPA 3H8JA 1EDEA 4C3ZA 3ZZUA 3Q8WA 2OBYA 4U7BA 1NT4A 1PUJA 5CEFA 3HDJA 1NN0A 2Z9CA 3LK7A 2WU0A 4FOSA 1VC2A 5IJZA 3UUGA 3KLOA 3KZNA 5THXA 2A1UB 2OG2A 1C0FA 4YROA 3ZETB 1X3NA 2HU7A 4Y1GA 1UXIA 1NDHA 4XUDA 3RYHB 3BZBA 1JA0A 1XVUA 4LZLA 3RVNA 3FOCA 5M29A 5IFLA 1J23A 4ER7A 1WDKA 1YT3A 2J0UB 4MVYA 1M1YA 1UR5A 3JQBC 2F3PA 5IAOA 5ISMA 3R6DA 1OKKD 2GUPA 3FFIA 2FVYA 2YOHA 1ADBA 3A6FA 2GDJA 2WV7A 1BW9B 1AV6A 3KZ1E 3THOA 1DKQA 2VG6A 1RWMA 4MR7B 4UU0A 2OORC 1YZ3A 1E60A 1P2UA 3DE4X 1F60A 4P3PA 1SH7A 4TV9F 5DW0A 2FETA 1JDSA 1KJYA 4F6CA 1CNEA 1PFWA 3CZCA 4XD2A 2RHOA 4C7VA 5HFAA 4B32A 4HNGA 1U28A 4ZVQA 3H2ZA 1RM3A 3IOMA 5HCIA 3Q12A 5LXTB 2WIDA 2AK2A 3RQSA 3G85A 1VGQA 3GB9A 3QMPA 4LC9A 1T3TA 2W93A 2YHBA 4YMGA 4R1SA 4NE7A 4EW6A 4R01A 2Y71A 1XXLA 1XUOA 3IMCA 3MT0A 3RVJA 2V65A 2C4TA 1TCVA 1YVUA 1CRLA 4HF7A 1BNCA 5BWMA 3CYFA 3KTOA 3L0ZA 3HY4A 2NV6A 3RWUA 1YFLA 4M1EA 3JWGA 4IF6A 5K8VA 1HRHA 4MGHA 4RK6A 2G1JA 2HQRA 4IMPA 4YMHA 3GJTA 2FN4A 5GADP 5JI3E 1SK8A 3CUSA 1NN1A 3GGDA 4EATA 2YFYA 1Y5RA 3AAPA 4N5IX 1S1XA 4AP9A 2HSJA 4DREA 1DOHA 1VLLA 2HRDA 5JSQA 4O4HF 3DT6A 3VYWA 3DUWA 4AMVA 1ZGAA 2O6HA 2P9PA 5E2AA 2AZMA 4DGQA 4AX8A 1P2VA 1XZFA 3J81O 5J63A 5JQGB 4L5CA 4BNUA 3G5AA 2J0EA 3HL8A 1VFPA 3C3PA 4JUCA 4MO5A 4BP1A 2BHLA 4U8HA 2WJGA 4G63A 4PAWA 4MB0A 4RCHA 3L82B 3K9KA 1SQ6A 3T34A 4L0CA 4Y1DA 5CNMA 1CY8A 1LLUA 4NNPA 4KC0A 2R8XA 4JNKA 3H6GA 1ZM4A 1NMDA 3L40A 3PRYA 2ONYA 2O5EA 3U61B 4KBGA 5K6AA 4IDBA 1Y1KE 4DDUA 1WXGA 3RROA 1H2HA 4JI2K 1ZD9A 3EPPA 1G7CA 1L8QA 1ZUHA 4IIUA 3ZCPA 1CETA 3QK7A 3ZHOA 4WKOA 2DFPA 3ZSYA 3KLGA 4PLHA 3U1VA 3F5TA 2QDKA 1E3EA 2AD5A 4DA9A 3VR3D 4AC9A 1UAAA 4L0QA 3M8RA 1NQVA 4QPZA 1PYOA 1JEAA 2NUPB 1W36D 4B31A 2WAMA 2VCEA 5DWQA 2H6EA 1GA4A 1RYFA 4NG5A 3AU9A 5CR4A 2F43A 1ZH6A 2P91A 1Z62A 3I2FA 4QNNA 2NNWA 1GCUA 5AKIA 4TTRA 3BL6A 5IVHA 2IXAA 5T4FA 3IPAA 1DKOA 1OAOC 1DIRA 10MHA 1Y8AA 2H4FA 2PSFA 3W5HA 2V6MA 1V2HE 1U1DA 5CD1A 3JQ8A 3TR8A 2H3EA 2H7VA 3AY6A 3PS9A 2Z2XA 2H7YA 3VPSA 5KYNA 5DM0A 2ATQA 4MUHA 2XUZA 3MFYA 4PQRA 3SM3A 4B1XB 2JK0A 5G0WA 3VOBA 1S0UA 3D4LA 2BEUB 2A33A 4P86A 1FP1D 4MRMA 4GI1A 3QUCA 3EUAA 4DU1A 3IUSA 5IS2A 1EVIA 2ASVA 3CPEA 4MS1B 4F5DA 1IG0A 3HBTA 3V7WA 3EXHC 1CJCA 2MSNA 2JI7A 3U0VA 3IS9A 3HYLA 3Q9SA 3KJVA 1AJEA 2DBRA 4OQEA 3M70A 3GBPA 3T5PA 3QB0A 3CERA 2C2GA 1P2BA 4KFSA 4YDQA 1KVSA 4FK2A 5LL6Z 3B53X 4RKQA 1BI4B 4CMIB 1QS0A 3D7MA 1ZH8A 2L19A 3O7MA 4WLEA 4HN2A 3MS7A 5CFZA 3JAMO 2XVMA 1PIWA 1Q16A 1ZBDA 2E1YA 3LU1A 1ARZA 5DOVA 3VBCA 1O6CA 3TJZA 3PLRA 2XGGA 5KINB 2OCGA 5AVXA 4EUEA 1K8ZB 2F9LA 1DXYA 5CD9A 3LYLA 3FYHA 4WBSA 1S7CA 2Q97A 3QEWA 4EMSA 1DAGA 2PYJA 1SKBA 1WIWA 4E4YA 2OV3A 4AZ3B 4FD2A 1LCIA 4LOJA 2NSHA 4BRDA 3WGQA 4KHWA 3K5MA 3TQCA 2Z2YA 3N0TA 3GOIA 3NO4A 5K3CA 1UJ6A 1WM1A 1YR7A 2I3ZA 4D8WA 3BL5A 4D0SA 1TMYA 3JYNA 2HPVA 1EVKA 4OHYA 2HDWA 1A5WA 4O0LA 4RIGA 2JIRA 3ZV6A 5J58A 4CMKA 3WWCA 5DE3A 3OFND 2I7VA 4EEKA 2ZR0A 3RWOA 1VLHA 3PHCA 4TQ9A 3RSLA 3G9TA 3GRRA 4DJ5X 1YFJA 4IJ6A 4L75A 3G88A 3JALA 3CCQN 4R81A 2ID9A 2PSHA 3O7WA 1KH1A 3ANSA 1N2GA 2BBSA 4H0FA 1BJKA 2HF8A 3HR7A 3IBTA 3L6DA 4XPIB 4KKOA 1IQ0A 4JVSB 5ALWA 3ZE7A 4UM7A 3KWGA 1FJHA 2YJ6A 3MB8A 1ICEA 1HL7A 4CR7A 4Y2YA 5JVHL 2AFRA 3KYIB 3OQBA 5LQJA 4PBTA 4GPIB 4EKIA 1U98A 4EKDA 5C12A 4B2LA 2H17A 2I1WA 4D02A 4N3AA 5HUHA 2PRSA 5JY1A 1UBKS 5AXBA 2Z6QA 1J39A 2GPSA 2NXEA 3K2QA 3MTJA 2E4LA 3LOQA 2QROA 4MKIA 2QIPA 1J70A 3R8EA 2VRCD 2A3RA 4XEHA 4CV3A 3J7TA 1JPNA 2OQRA 1AU9A 3NUZA 4XGQA 3ZD9A 2VAMA 2JW5A 1S2MA 1NXXA 4KUEA 1YZKA 4WCFB 2AOTB 1OCEA 3B5IA 4QUEA 2VNSA 4HYTA 1DKPA 5TV2A 1UZLA 4CRWB 5DYGA 1DKNA 3TZ6A 4E14A 5KGWA 2ZTVA 3HSYA 3ACBA 4PX3A 3MOIA 4DSEA 3ZK8A 3OS0A 3F3SA 1TJ4A 1U2ZA 4HEA6 4C87A 3LDQA 1PLJA 2I3GA 3FBWA 2X0DA 2Z8YA 2ARKA 3KKPA 3S29A 4XCXA 3E66A 2YX6A 1IOVA 3TI9A 3I76A 1K27A 3E9DA 5K5EA 4LFAK 1PW5A 1LNQA 3G9XA 5HM6A 2XD4A 5JXGA 3MOGA 1VJ5A 2V9PA 3DKVA 3T3EA 4BEJA 3DFIA 4ENTA 1CP3A 4K9RA 2ZUWA 1CJTC 4YPFA 1NJXA 1QFXA 1T34A 3PIRA 3MXIA 2BLNA 3PPVA 3EPHA 5L3QA 2G6TA 2G7MC 4IR7A 1B1CA 4PL7A 1QG2A 3ID6C 4PAGA 3FOWA 1UINA 1F51E 1CQIB 3VSCA 1MOZA 1RXIA 1YI2N 1Z5ZA 5JR3A 3VM6A 3KJFA 2ZJ1A 3AL0C 2ECQA 2C8VA 4OEHA 4M36A 4IOKA 4PL8A 4PS1A 1E7SA 5BSFA 1NC3A 1F17A 1DAPA 4X54A 3SQDA 5ETJA 3O0DA 4EA6A 4CFYA 4I1IA 3OOHA 3RK0A 2B69A 3T0GA 3KPJA 5K6TA 3OQPA 2EFEB 3JU3A 4QVKA 5LZ5A 1T5SA 2HHWA 2C7VA 1G98A 3DL4A 3MYYA 1U7OA 1XYGA 2BCJQ 3KM0A 3R9IA 2JD0A 1QHTA 4J94A 2GEDA 1RRMA 3VR2D 3R9PA 3MGGA 1XC3A 1T4DA 3O1WA 1R27A 3DHYA 1RM0A 3AVNA 5AUPB 3IBYA 1T5BA 1OXTA 2QUZA 3L92A 1BD4A 3FOZA 4OSOA 1GKKA 1WNSA 4CZLA 1RDCA 3ZHBA 2UXCB 1ZUNB 3OOJA 3R6TA 2QJFA 1EXWA 3PNMA 3F8SA 4H2DA 1JA9A 1JR3E 4D9BA 3OOWA 2ZUVA 2GCEA 5KOJA 3QX8A 4LF9B 2C3OA 1C3VA 1DT5A 5CEJA 3FPHA 2W22A 5ANRB 2P8JA 1U1GA 2AQHA 1VE7A 3NBMA 3PFBA 3U44B 1CUYA 3CX7A 1WCWA 1BA2A 5REQA 1SU6A 1DQRA 3SVZA 2ZT6A 4POOA 3N0RA 3L6EA 3RTVA 3LBYA 4ALIA 4B6RA 3B3FA 1FVXA 4XIJA 1E3MA 3OTHA 4P6VF 4DFJA 5ECDA 4K0KK 2QUJA 2YH2A 4D6PA 1D09A 2WE7A 3LI2A 2C57A 3MMVA 3E9NA 4DUYB 3QV1A 3ETCA 3EZ5A 5FRNA 1ZC4A 2HF2A 2SICE 4XX0A 3WWDA 3UJ3X 5AJTA 2GUGA 3L77A 1MQAA 1QVRA 1A7KA 1DL5A 1IN5A 1SURA 3KHUA 2OESA 5KIAA 2QTAA 2Q3FA 4M9QA 4DUZK 4DWJA 3KZCA 1M2OA 2XI4A 2QJTA 4EBBA 4L22A 5CT8A 2VBFA 2Y1XA 4NCXA 2YXEA 1WDTA 3A1WA 1IQRA 3LFUA 4LJSA 5EKSA 3H3OB 2QRUA 2UXCK 1N57A 1UC8A 4F5WA 3RKRA 1NR1A 2C2WA 1E8NA 1Z6AA 1WTAA 2GO1A 5DULA 4LBYA 2W4IA 2PEYA 1UPUA 4S3MA 3CB2A 4LF9K 2NX2A 3TLBA 4YRLA 4ZIRB 1C1HA 5JYCA 1KO5A 1IKYA 2GPBA 1DHRA 2P4UA 2A0KA 5DXAA 5DHRA 3A2LA 2JBWA 3ESBA 1MZVA 2VYNA 3QW4B 3X2FA 5IBPA 4E2FA 1HYZA 2GHRA 4V2UA 4LQCA 2YYYA 4MTLA 1P7WA 2B3DA 4G5RA 2OCPA 3IESA 3LCCA 2HVHA 4PRZA 3ADCA 2VK4A 3GFPA 4FU0A 2OAEA 4MNTA 1OXUA 4O2BA 2C5SA 5JARA 3A7DA 3CYMA 2IODA 3UK0A 3A1TA 4C6SA 2VRBA 1Q7YO 1P18A 2UYHA 3E7FA 2WPNA 2Y76A 3QF4A 4UUQA 4WLVA 5FXMA 1FL9A 3M5DA 2F4NA 4YXFA 4BKOA 5FNZA 2PCLA 5EQJB 4JASB 1TIBA 4JBWA 3ZT2A 4BX3A 4EHFA 5FX2A 3BE4A 5P8WA 3UK6A 1A9RA 3UV6A 1LEHA 3O4WA 5E0OA 3I73A 4ZYXA 1UT8A 2ZVPX 3L4QA 4PZCA 3ISNC 4AJOA 3AVCA 3SVTA 4KXYA 2D1YA 1JXMA 2X2FA 2B5WA 2P3OA 3K71B 5AVRA 5C46F 3G2NA 4U2GA 1SAYA 1N6HA 2OGSA 3O73A 2M6RA 3A05A 4DM4A 2OHVA 3MWDB 2E6LA 2BTQA 1WKBA 1MDUB 2HSDA 3GFSA 4Z0UA 3KD1E 3PT9A 4PRYA 3SBTA 2P9IB 5F2NA 1DCMA 2FPGA 5ALZA 2AZ4A 3T41A 4PCVA 3GK3A 4ED9A 3D45A 5LL6P 2J5BA 5G53C 3JQFA 5J2UB 1X9IA 5CB4A 2FFBA 2X5OA 4BWGA 2BE7A 2I7TA 2VHJA 3UKRB 1UL1X 1ESEA 5J1SB 3SUQA 4FMDB 4OSPA 2I9KA 1M1NA 2B4TO 2XT6A 3I61A 3C6TA 4YRDA 3C6YA 3B89A 5L3SA 1PQYA 3PNQA 5JJBA 1U1IA 5B6PA 3VR0A 3SJZA 5EUQB 4D45A 5EE0A 3TAEA 2J1LA 3T1TA 5ALLA 2IHUA 2V54A 1M6VB 3HGQA 1CD5A 1P0QA 5ICFA 3V1TC 1CWUA 4CBVA 5AH0A 3KVGA 3AUJB 1RXUA 4E5YA 2XT0A 4ISEA 2K2WA 4FSVA 3IAYA 1WQ4A 3DRPA 5C7OO 5FOQA 1T4GA 3FUUA 4MW5A 4ZQBA 1NOYA 5ICMA 1NUSA 3TXYA 5JQWA 3F90A 1YQGA 4E08A 3IIKA 1L4NA 3T1HB 1D2NA 2NZ2A 2ETJA 3FGUA 1QNLA 1WPXA 2C9MA 1OY1A 5FFMA 3KZKA 4B3IA 1TQ6A 3N2YA 2FSIA 1AXGA 3NF8A 2QL7A 1Q18A 4JJ4A 3LPTA 3SNHA 2XKJE 3UA4A 4OGEA 2HDNB 3V46A 5BMVA 2OZPA 1XDDA 1N2CE 1ZRSA 2CHGA 2QX8A 1W30A 3GRYA 3KK2A 1GAEO 2HNAA 1U0GA 3I9KA 3L8ZA 4M8KA 1LSJA 2JFQA 3G7NA 1ENZA 3PPIA 1YHQN 1SD5A 4RMNA 1ZBQA 3GL9A 2CD7A 1JSRA 4TOIA 1GZ7A 3VOSA 1E9EA 3PE4A 4L08A 2RHBA 3VMMA 3KBBA 5A4MS 3DWFA 2FPWA 5JZSA 4Q1VA 3B7PA 4RWZA 1N6QA 2CCJA 2AA4A 1O5OA 4LFCK 4M1WA 3COZA 5HJ5A 3VPBA 3ZVMA 1A9QA 3EQZA 4LC0A 1IUOA 3COYA 1E1RA 4FJ0A 4E1VA 1ESZA 1PTJC 3ZT0A 5IJ0B 3RVKA 5C4GB 4CKBB 2CB0A 4J90A 2PUHA 4RQTA 4BX9A 1TU0A 3GLTA 4KOAA 4EIWA 5M04A 3OQ6A 4R5MA 1XAIA 2IJGX 5HE9A 2E2PA 3WYBA 4N9WA 5HMMA 2HT6A 1IYZA 4HO1X 3I0SA 2BL4A 1XOIA 4CHGA 3T1HK 2PAFA 2EDCA 2CWWA 1T8EA 1KCFA 1P60A 3BREA 2BONA 2JK1A 2IHYA 3WYAA 3CNBA 4WGGA 2PZJA 2CYBA 3ALYA 3WXKA 4EABA 1Z4KA 3WXMB 3RR2A 2B5OA 1IJFA 1ZAKA 5EA2A 4B3MB 3CD6N 1C9DB 1YL7A 3RR7A 1E3TA 1WSIA 3EPJA 1FYDA 4URWR 2IDJA 1SIOA 1VRCA 3EXIB 5EVJA 4CIVA 1A97A 5LYJB 3RIMA 2DX7A 3IEKA 2QSJA 5DGHA 1A9ZA 3HR4A 1QGUB 1ZKDA 2GO7A 1SUAA 3EWSA 2D13A 3WT0A 1JLEA 4E09A 5F7XA 1GVHA 4BNIA 1XKXA 1KQNA 1GL3A 2VXOA 3K9WA 1SXPA 4LMPA 2VJQA 4GEGA 4KRGA 4ZOQI 2R96A 2XTZA 1FXSA 1RZRA 4CF3A 2W00A 3F3KA 3KKZA 1R0LA 3KEGA 1YK1A 3FMPB 1EA5A 1HTTA 4PIMA 2WW8A 2H7CA 4QBTA 4F0JA 3DBVO 4BDTA 1LW0A 2P79A 3ULEA 3JPYA 1R9NA 4YK7A 1DO8A 1W1IA 1IV0A 4I81A 4MGKR 1DAHA 2HBQA 1LAWA 3TAPA 1R4NB 3SHTA 1L7QA 3P0FA 4DRXA 4V1CA 1NXPA 5M1PA 5DRYA 1W48A 4RLHA 2ZWMA 3E1SA 2O8CB 3LH5A 2OSVA 1R0AA 3SVLA 4EGSA 4FTWA 2J30A 1W19A 4R9SA 4Z7NB 2AI2A 2IHZA 2IGIA 3ZYZA 1GAWA 2BELA 4PKIA 2K5UA 1KL7A 1FMTA 4IJUA 3LUFA 2FG6C 2Y66A 2AG8A 1TIKA 2FQYA 4DCOA 2WICA 4E6PA 3WO1A 2HMVA 3KWJA 4KYIB 1RRVA 1MO5A 4FZJA 3TQHA 2GH1A 5DDIP 3TL3A 4UVHA 1E7RA 1W49A 3BHIA 1HDCA 1WJGA 1USWA 5IARA 2O8NA 3HJUA 4CEIA 4NCNA 3R20A 1UWLA 1LBIA 5IAKA 1KZ7B 1Y9JA 2O3TA 3ZD6A 4DGSA 5HRPA 2QGZA 1JP7A 2MIIA 4I1RA 3LDHA 1JQDA 4FLVA 1Y4DE 4IDQA 1T9DA 3IRXA 1BWFO 3ENOA 4CK3A 1C7QA 5HLFA 1DEHA 1OI7A 4QGGA 4TLMB 1YACA 5FB3A 4C1NA 1FFXA 1QORA 1RHUA 5LP6C 3LRTA 1BG3A 4LKOA 2C77A 2R44A 1SL2A 3P9PA 4UDNA 2J9FA 3QU5A 2EEZA 1U7UA 3PB3A 3ZOZA 2IV2X 2BV3A 3NC0C 4YCAA 3K8OE 3F7MA 3H1BA 1UUFA 4TUYF 4K6FA 1YZVA 2AN5A 2ZD1A 4LBWA 4L27A 2ZYHA 1P7ZA 3MINB 1UAXA 1XALA 2EJTA 1K6XA 2W6IA 1QRTA 3L1KA 3HUDA 2CC2A 1Y7TA 4E6EA 1MA9B 4LTNA 3QMMA 4O4JA 5EZYF 5EIBC 3HCAA 3TAFA 4KRXA 3L8HA 5IJXA 4YTEA 2D54A 1CW2B 1EA7A 3ZY4A 4BVJA 1HM5A 1VCNA 1MDFA 4O5OA 2JGDA 4FUTA 3ZEUA 1SQ0A 2PTGA 4ZCLA 5KTOA 4CU2A 4OVKA 2P62A 3AKZA 5K8LA 1R0RE 3OLWA 2EL7A 3DG9A 3WQRA 1TQHA 4L73A 4V02A 1OC4A 4KFTA 3RARA 4EX6A 1NAIA 4O2RA 1GNQA 2QWLA 3P94A 3HCEA 5TGDA 3FYUA 3M4JA 1SCDA 1SEVA 1WSGA 3LT5A 3A1FA 5JHHB 3HJBA 1SCKA 1DBSA 4G86A 5JECA 1WRBA 4GI3A 1B42A 2XX3A 3FAKA 1REQB 5LMUK 3G7UA 4DB4A 5AQUA 2NZXA 1LRJA 2PK3A 2E6UX 3CW2A 4QYIB 2VZ9A 4GM0A 2OD7A 1NVEA 5E1MA 3WLAA 3V7FA 2WJIA 4Y3UA 1OYYA 1S9GA 3WXLA 4K6HA 4HHTA 1ZBFA 2JZOA 1H5UA 1KORA 1ZHOA 1RXEA 1X9HA 1ILEA 1I2MA 2WTAA 4EB8A 1KSGA 5KRTA 5EMJA 1RT1A 1JEQA 5KSPA 1IY2A 1W97L 4HUEA 1GU0A 2C84A 5EIFA 1U0BB 2JS7A 1J8VA 3ZHZA 1KFJB 4BNVA 4ELVA 5TQ0B 4M7YA 5DCYA 2VPWA 4PKHA 2XE8A 4AF6A 2FQQA 4I5EA 3W3AA 2DPNA 2ZUDA 2B8JA 1XZIA 2A9JA 2Z5GA 4FWSA 5GZ6A 2EP8A 4NBRA 2R5WA 2F55A 2WDPA 4TKLA 1ZR4A 5AOBA 4P92A 2E21A 1KI6A 2JLRA 3THRA 1KYQA 2HMIA 1UKBA 2MWMA 2QMOA 2QE7A 1EHCA 1IB0A 1H2WA 1CHNA 1M54A 2IYZA 4R1OA 3GIDA 3VPHA 4AHCA 2DOKA 3AFNA 4CJQA 1YIAA 4F7WA 3L6BA 1WTCA 3I9OA 2VNKA 3L7YA 2CUKA 1SVIA 5BVGB 4MUYA 4HBZA 3PUYA 3D8TA 2WU1A 2XA1A 4M0LA 5SYMA 4NQZA 2RGYA 1UMDA 4J7XA 3DT8A 2VJLA 3TYXA 3I04M 4MWBA 1YC5A 1GUAA 3PGVA 3OC0A 5INTA 5B6JA 4L1UA 1RADA 1P2DA 5IAGA 1BWSA 1J2EA 1Z05A 3TAUA 1GDHA 1FUEA 2EWVA 4XD7A 4F4CA 3HKBA 3JQRA 4OJMX 3MIIA 1EGMB 4FJMA 3SS9X 5ENVA 4NCJA 1J0BA 3VQAA 2BR3A 1CERA 1QK4A 4ZQCB 3ABOB 5DTJA 3MN9A 3ZDRA 4C7KA 1DWPA 3K35A 1YV9A 2YXPX 5AW0A 4RW8A 3CMMA 4LF5B 3BCHA 4EHUA 1YD7A 2I91A 2EG5A 5KCMA 3IYLW 1MTOA 3DVSX 3ELUA 3GCDA 1USKA 5LQNA 2NRVA 4FLZA 4RPHA 4UD2A 3H42B 1U94A 4HNRA 3SHQA 3DEYX 1T9GR 3G9ZA 3KKQA 2AB0A 5HJ2A 4N65A 1P5ZB 1A5XA 2BVNA 3T1NA 3UJPA 3T4XA 4IHJF 2VGMA 3DMRA 5IH7A 4NB4A 3PC4A 4JI8B 3H9QA 4U7PB 3SBXA 4QSMA 3T9BA 3N1UA 5CLFA 2F62A 2LVBA 2Q1UA 4YMWA 3AOGA 1KQGA 2VYVD 5TMDA 2XW6A 4LDZA 1KGSA 1EGHA 1ISRA 1PV2A 1LZLA 3IJ5A 4UAUA 2CUTA 2HXYA 3RT1A 1ECJA 1YDFA 4GMDA 1X74A 3L2QA 3Q9NA 4BB0A 2G9RA 5KNLA 2QKBA 4KLZA 3QKSB 1SBHA 3A9VA 4J1NA 3ZDAA 4N5DA 1IK6A 4E19A 1GRQA 5KC9A 5D00A 2NACA 3ZWKA 3UUEA 4D26A 3I5XA 2L0XA 4JEPA 3IR7A 4H7DA 4H0VB 3ND8A 1PO7A 3S3TA 3WS7A 3E7PA 3IR6A 4C0QC 5B3JA 4WZBB 1NM1A 3WTBA 3DZ8A 3KLNA 4ZVKA 1G2IA 1GRCA 4TWJA 1WA5A 3P2YA 1TQ8A 1EK5A 1TYDE 4P54A 1NMNA 3CF6R 2IV3A 3G89A 5F2OA 4U7FA 5IFKA 1GYRA 2ZZKA 2ZWOA 1RYDA 1N6RA 4BLSA 2BGTA 5FEMA 2OCAA 4OXKA 3LFHA 4CBWA 3BA6A 3I2GA 4BG8A 4A62A 4EFHA 3HTVA 1G4UR 1MO4A 4IXTA 5IG2A 3H1GA 3A2KA 3Q85A 4RW0A 3RSQA 1FBTA 3OPVA 1YI8A 2CN1A 5DI3B 3RJTA 1OFUX 4D3ZA 3Q6IA 3NMUF 3OJCA 1T9ZA 4MEBA 4O8ZA 3NRJA 3Q6NA 4FSXA 2D5RA 1E2MA 4QQFA 1PNTA 1HMYA 4NARA 1AF7A 1UXHA 3BF7A 4DARA 1YT5A 4BJHB 2CLCX 3B6JA 2NVUB 3MCWA 2JLEA 3CKMA 2WJAA 3OICA 4WTOA 4CU5A 3L6RA 4B08A 1S02A 3ROFA 1O6GA 3D6JA 3PRJA 4MA0A 4YOTA 1Z7GA 4UZEA 2YJ4A 4MKRA 1PR9A 4MDYA 3BY5A 2VA9A 3MMPA 2VG8A 4OBWA 3TD9A 4GMXA 3ANTA 2CUNA 1KK3A 3A2NA 2HB6A 4RJKA 4WDRA 1E1QA 3C3AA 3I42A 1TUYA 2JHGA 1I3MA 4PONA 1NBIA 4AL4A 1T5LA 4BO2A 3ZBPA 4KDEA 1SVSA 2UXDK 4X5OA 3W1EA 2BEWB 5HIIA 2VUHB 4OB6A 4Q03A 4CM1A 1GTSA 3DAFA 1BYIA 5LP6B 4JS4A 5H8WA 1RJDA 1ZJYA 1DPFA 2CFOA 1EFRA 1RLUA 2CV0A 1H23A 3O3MB 1ULHA 2QTMA 1D2CA 1EHYA 2PXXA 4MAMA 4Q9AA 3AA3A 4DMCA 4V0RA 2L42A 4AZ0B 3RQIA 1UP7A 2P4SA 3AY7A 4ND8A 5IZCA 2ZI5A 3M1AA 4G3XA 3V6LA 4UXIA 1R8YA 2FBXA 3MHPA 2GR9A 2R60A 1ISHA 3IFSA 1FUIA 4Z0NA 2WD8A 4MWEA 4C20A 2J32A 4CN8A 3DEIA 3L8GA 1R5NA 3AFHA 4D9JA 2BC9A 1CK4A 2Y0EA 1PSDA 1XFDA 4H31A 1SB9A 1JQBA 3T1YB 1Y5MA 4AP6A 3D4OA 5J2QA 3DP7A 5EJ7A 4R5PA 1R5JA 2EERA 3COPA 5KOIA 3BTOA 1QVVA 2FRXA 5DHTA 1U7TA 4PCAA 2GN6A 1FSFA 1PVOA 4ARUA 4U0KA 4G8CA 4DYDA 3RCBA 4L7QA 4UHHA 3F6RA 4B73A 3TWHA 2QOEA 2DT5A 2WU3A 4BRHA 1W5BA 4AMBA 2HQOA 1Z4MA 1R64A 1NFQA 3QOYA 4NZMA 1G4HA 5C4IA 1YO6A 1FU8A 4M0DA 4G01B 1EIZA 5HKBA 3QNOA 4D92A 3CUWA 2PSDA 8LDHA 1FFEA 4Y6QA 3C7TA 4KACA 4CEJB 3E61A 4JN6B 4W7SA 2ZE5A 4HRAA 4JLBA 3YASA 5AQEA 5ABPA 5DYIA 3FB4A 2HHSA 4DR6B 3IAS6 4JYCA 5AZIB 1W52X 4PGHA 1UBRS 4BGIA 4PYNA 4C4RA 1G41A 3ZWVA 4K3UA 2ASEA 1GAQA 4Q5VA 1L8XA 4KX5A 1B00A 3J8AA 3X2SA 5CFLA 4OUDB 2AMVA 3N07A 4ZI2A 1QX3A 1FYWA 2C04A 3B6PA 2GBIA 3SJCA 1IY9A 1DVRA 3BS4A 4BUCA 2GBPA 3DBRB 1KVUA 4BE1A 3SR0A 1ULTA 5FL7D 2HBZA 4HEQA 5K05A 3AO5A 2WONA 3GFFA 5T67A 4QELA 3PUKA 4LNHA 1LDNA 4KQ9A 1OTHA 3AY0A 2H85A 1OWPA 2XHEA 3QF7A 1NX6A 3BDAA 2IQIA 2ORYA 1WKCA 2VWQA 4K1XA 2PUGA 1V5EA 1J2YA 1YQXA 1GKLA 1M2VA 4EVIA 4V2IA 4Y6OA 5CW1A 1G1AA 1LV7A 3L7OA 1CZBA 2FK7A 4B9EA 1Y81A 2QD4A 5CAEB 2FFAA 4BN0A 5HZHA 2FP4A 2QYTA 3OTIA 3CUVA 1R4MB 2HW8A 3BVPA 1CF4A 4PLTA 1EP9A 4EHBA 5IWCA 5JFTA 1N34B 3OZXA 1HT3A 1KZ9A 1I51A 2WJJA 1M2FA 4J1SA 1SXIA 2UZ3A 3QINA 3W0LB 1BMQA 1AN9A 3W8FA 5GY7A 4O4IA 2EYUA 3BIWA 5LNK6 3X1WA 5C7YA 4E70A 4BVKA 5AQGA 3CLRD 3EVGA 2EFJA 4IBNA 2TYSB 4FFDA 3CR3C 1BE1A 4IINA 3LKVA 4CLRB 4O0JA 3AQ4A 2J9GA 3WLPA 3KRTA 3RF7A 1T8TA 3DDHA 2W42A 4LGCA 1H8EA 2E8AA 3QEMA 4IDGA 3L0OA 2X8JA 3NPMA 3T9EA 1X7YB 1U4SA 3GRPA 3FA2A 4GPTA 5IPFA 2OKGA 2QRNA 1J4AA 5BNTA 3A27A 3WYFA 1K3TA 1Y1PA 4KK4A 1IM5A 3W04A 1SA0B 1XDGA 4H6VA 2YWJA 2P1ZA 4TVSA 1MW8X 2UYQA 4GXQA 5DEIA 1KAEA 3WWOA 1UDRA 3DWEX 1Q6ZA 1SKUA 5BVHA 3SU8A 2RB4A 3D6HA 1C50A 2LKDA 1QUFA 1SZ2A 5DNAA 2H0AA 3TZEA 5FLXO 4AO6A 3RB8A 3COJA 3PIDA 1AZLA 4R51A 3E9PA 3UNXA 2B9EA 2IP4A 3MJFA 4PVCA 4BO7A 1SXQA 3D7EO 4B4OA 1L5NA 4II2A 2Q45A 1KZGB 1N34K 3KXDA 4ETMA 1THGA 3SEQA 4BR2A 4G2TA 5DCUA 2QA4N 2QAJA 1UBHS 1RKXA 1VL8A 4Z4GA 4I4TA 1QFZA 3PVCA 3RYTC 3L7NA 3T94A 4F3OA 5BO5A 1EWTA 4JEHA 4NSNA 4MWDA 4NULA 3K96A 4WIAA 1E6WA 3SYTA 3KOWA 1F8YA 4L6AA 2GEBA 4Q3OA 5EOYA 5J2PA 1E9BA 1K3UB 1WZ2A 2WMNB 3UJNA 4JI2B 1REVA 4RTNA 5IF3A 3HP4A 3PC3A 4CGDA 1N9ZA 1AUQA 4I50F 2FN9A 4QXRA 3A3YA 3PY8A 1VLMA 5EKTA 1M9NA 3VTIA 2BLLA 4KRYA 3AUYA 4HWPA 3K6SB 1E0DA 4K40A 2Y99A 1FTYA 4OLAA 3V1RA 3HCRA 4WUVA 2G8WA 4JKCA 3OEEA 1B14A 1T5OA 5LP1A 4KR3A 2NSLA 1A4XA 3T7KA 4HDSB 1PRYA 4WOJA 3ADDA 3Q2KA 4W5WA 3DW1X 3ND6A 3ZE1B 3CG7A 1DX9A 1WAMA 3AI2A 2A78A 4M9ZA 4QDUA