5T7BA

Argonaute-2 - 5'-(e)-vinylphosphonate 2'-o-methyl-uridine modified mrttr guide rna complex
Total Genus 227
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively.

Total Genus
227
sequence length
837
structure length
802
Chain Sequence
FKPPPRPDFGTSGRTIKLQANFFEMDIPKIDIYHYELDIKPEKCPRRVNREIVEHMVQHFKTQIFGDRKPVFDGRKNLYTAMPLPIGRDKVELEVTLPIFKVSIKWVSCVSLQALHDALSGRLPSVPFETIQALDVVMRHLPSMRYTPVGRSFFTASSNPLGGGREVWFGFHQSVRPSLWKMMLNIDVSATAFYKAQPVIEFVCEVLDFKSIEKPLTDSQRVKFTKEIKGLKVEITHCKRKYRVCNVTRRPASHQTFPLQQESGQTVECTVAQYFKDRHKLVLRYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIRATARSAPDRQEEISKLMRSASFNTDPYVREFGIMVKDEMTDVTGRVLQPPSILYGGRNKAIATPVQGVWDMRNKQFHTGIEIKVWAIACFAPQRQCTEVHLKSFTEQLRKISRDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYAGLQLVVVILPGKTPVYAEVKRVGDTVLGMATQCVQMKNVQRTTPQTLSNLCLKINVKLGGVNNILLPQGRPPVFQQPVIFLGANVTHPPKKPSIAAVVGSMDAHPNRYCATVRVQQHRQEIIQDLAAMVRELLIQFYKSTRFKPTRIIFYRNGVSEGQFQQVLHHELLAIREACIKLEKDYQPGITFIVVQKRHHTRLFCTDKNERVGKSGNIPAGTTVDTKITHPTEFDFYLCSHAGIQGTSRPSHYHVLWDDNRFSSDELQILTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKRDHQALAKAVQVHQDTLRTMYFA
Loading diagram...

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

publication title Protein structure
rcsb
source organism Homo sapiens
molecule tags Hydrolase/rna
molecule keywords RNA (UVP)UAUAGAGCAAGAACACUGUU
total genus 227
structure length 802
sequence length 837
ec nomenclature ec 3.1.26.n2: Argonaute-2.
pdb deposition date 2016-09-02

pfam database annotations

chain Pfam Accession Code Pfam Family Identifier Pfam Description
A PF02170 PAZ PAZ domain
A PF02171 Piwi Piwi domain
A PF08699 ArgoL1 Argonaute linker 1 domain
A PF16486 ArgoN N-terminal domain of argonaute
A PF16487 ArgoMid Mid domain of argonaute
A PF16488 ArgoL2 Argonaute linker 2 domain
Image from the rcsb pdb (www.rcsb.org)
cath code
ClassArchitectureTopologyHomologyDomain
2.170.260.10 Mainly Beta Beta Complex paz domain paz domain 5t7bA02
3.30.420.10 Alpha Beta 2-Layer Sandwich Nucleotidyltransferase; domain 5 Ribonuclease H-like superfamily/Ribonuclease H 5t7bA04
3.40.50.2300 Alpha Beta 3-Layer(aba) Sandwich Rossmann fold Rossmann fold 5t7bA03
2PUDA 3K59A 2GI4A 2E6LA 1C1CA 3O4NA 4I2PA 2FMIA 5CHYA 1ABFA 1JLBA 1WSFA 1QKKA 4QYWA 1NXXA 3AA3A 4CEFA 3V9ZA 2J48A 1SKRA 2A1RA 4CBVA 3L49A 2PYJA 3KYJB 1FKOA 1QHTA 3RVNA 2MSWA 2QXFA 3MXIA 4FZYA 2XY8A 1RDAA 1DLOA 1C1AA 1ZBFA 2WJAA 3F7NA 1X1PA 3SJJA 2VG7A 3BDPA 1ZITA 4H8KA 4GMJB 4FM2A 3O1JC 4OTZA 2WY2D 4DTXA 2PE5A 3N53A 3AVGA 2N9UA 1BVHA 4F8RA 3T95A 1RBUA 4G0XA 4YRZA 1C6VA 4WXMA 1N5YA 4IBNA 3IP5A 3CZ5A 2G8FA 1SXGA 3SG0A 4IMIB 4RY8A 5CYMA 4ETNA 3T3FA 4YNQA 3G1WA 4N41A 3RR7A 4BE1A 4E0DA 2P51A 2IS3A 4CEBA 4KHUA 2QSJA 1ISSA 3QEIA 4C8NA 3NH2A 1NY5A 2FQWA 1RBSA 2AYXA 3FFIA 1C1BA 5FDLA 2HW3A 1LW0A 4CECA 1EFAA 2HNYA 1AB5A 3PV8A 1NK7A 4XXHA 1P6QA 3HUTA 3MEGA 4CF9A 3LUFA 1EX4A 1TKZA 2Q5CA 4RK7A 4EYOA 4DU1A 2MSKA 3TANA 2X7XA 4E89A 5KC9A 3QETA 2M1ZA 5C24A 1JLEA 3O2QB 2R48A 3MJ0A 3O7XA 1FFWA 4BDZA 1QSYA 3V4IA 3IP9A 1RILA 1RT7A 2MSLA 4ELVA 2IGIA 3F9KA 1ASVA 4CK1A 4RK5A 4JRPA 4DTOA 4ZHRA 4O0IA 4Z0NA 4FVMA 1UWBA 1S1VA 4Y1CA 3EQZA 1ZBIA 5BRJA 3MAQA 1ZGZA 2VWKA 3HPHA 3OMXA 3V9XA 2FEKA 1YK1A 2L18A 1GUDA 1TKXA 4OJRA 1TKTA 3DLBA 2Z1HA 4RU1A 4ZPJA 1WSGA 1TK0A 2HHQA 2WMYA 3JPWA 2GBPA 4C8KA 4W5QA 3QLVA 1BQNA 3QEPA 3B6PA 1ZGGA 4DF8A 4DTJA 3QLUA 4ZMRA 4YR7A 1HYZA 3DOKA 3Q15C 3VNAA 3H5OA 4WWHA 5D3GA 2FEWB 4G97A 4KTWA 3ZSVA 4JP1A 1EHCA 4F8JA 5JNRA 4WE1A 4KPYA 1HMVA 1HRHA 4OLBA 2GX6A 3MECA 1RTJA 5EWJA 3C3KA 3SQNA 5PNTA 3VA0A 1IH7A 3QLHA 4IILA 3SQ4A 1R0AA 3MM4A 1JYFA 4W5NA 1JBEA 2B6AA 2FBTA 1Z13A 3QX9A 3FDFA 3LP1A 2HHXA 1RNHA 4CEOA 3DGEC 1RT2A 4OBBA 4R5PA 3N75A 1DBWA 4F06A 3C3MA 3NH1A 4H60A 5IUKC 3VA3A 1WAFA 3DI6A 4IFVA 3OYHA 2G8VA 3LKBA 1T2SA 4E1NA 4BACA 3KLIA 1E2BA 3DM2A 4RG8A 4B9SA 3RVQA 3TAGA 1JL2A 1TL1A 3OY9A 3ROFA 3SV4A 5F64A 3L3VA 3AVBA 1JLCA 4KMRA 1DRKA 1XC9A 4FZZA 4CJEA 5E3JA 3BRSA 3D02A 1K6YA 3GA5A 1NXSA 3V6DA 4FJLA 1ZN2A 4E7PA 2OQRA 3AVFA 4MAAA 2HQBA 1OXBB 2BANA 2QXYA 3ZSOA 1SKWA 1JYEA 2FBYA 2XY6A 1BIUA 3S3NA 4G0MA 3A0UA 4CHYA 3NE6A 4NCAA 1HYVA 1X9SA 2ATQA 1NXTA 4HUFA 3H1EA 1VSEA 1KGSA 3P5JA 1QNLA 4NQRA 3HDGA 4H3HB 3CG4A 4CJQA 5J2PA 3SUNA 3SUQA 3LFTA 4UHJA 4HVJA 3HL8A 3T1AA 3I0RA 2F8TA 4HCBA 2WRZA 1ASWA 2BDPA 4XFKA 5DLEA 2KZMA 3L2RA 4C8MA 3OM0A 3HUUA 1NOZA 4FLUA 2IKSA 3IG1A 3T19A 3O3IX 2IPNA 4Q5VA 2FN8A 3CNBA 5KRTA 5KWSA 4L8RB 3UKJA 1F21A 4E7IA 1D1QA 5T3YA 3P9YA 1W25A 4KFCA 1UAXA 1RCHA 2NZVG 4EVSA 2QKKA 2MYTA 1DC7A 1FFGA 1TL3A 1L5ZA 4LH5A 4Z99A 1NKEA 1L3UA 5FWYB 1ZESA 4OKJA 3QNNA 3RVOA 1BQMA 3OYJA 4M3UA 4F2RA 3K5OA 4B3OA 2HHSA 1QS4A 3TAEA 4MQEA 1KSPA 1TK5A 4UHKA 1ISRA 3RRGA 1E6MA 1KFSA 2VG6A 1BAPA 3FFTA 4DSJA 1RBVA 2HHWA 3IS9A 4ZMSA 3VQ6A 5IBQA 2ZAYA 4AHSA 4O5BA 4YS6A 4M3WA 4NGFA 1W9HA 3GBPA 3DLGA 2P4UA 2QVWA 3QX8A 1FK9A 1QP0A 1U2QA 1I3AA 2NT4A 3OLXA 3PUFA 3SY8A 2KQ2A 2PUEA 3SUOA 1U45A 1USKA 1NXPA 2AYZA 5FRNA 4N0PA 4DTMA 1FXXA 2HHTA 4KK3A 3V81A 4KV8A 4DSIA 5FRMA 2L5DA 3O1IC 2KFZA 1DCKA 1BGXT 4CJSA 4KVFA 4O55A 4FLZA 4C8OA 3HK2A 4O44A 4RY9A 2BE2A 3VQQA 4B9MA 1XWWA 3Q9SA 2QV0A 4CGDA 1P6UA 2HMIA 1IKWA 5HBMA 1IKVA 2XHBA 3NNSA 3DLKA 2V0NA 1TV6A 1D5WA 4MRMB 3TAPA 3DMJA 1AB6A 1DP4A 5FWXB 5I4CA 1ZDMA 4FJ9A 1Z25A 4NGDA 1PNRA 1HJRA 4N76A 2ZQBA 3LPUA 4OATA 5HLFA 3DRRA 3RMCA 3MXJA 2L19A 3SV3A 4MLDA 3OJSA 2FQYA 1DBQA 4DQQA 4KNYA 1D8YA 2P1JA 4OVLA 2OA8A 5KI6A 1YK0A 1EP4A 2QVGA 1RDBA 4W5OA 3RVKA 1QTMA 4CGIA 3O74A 3OLVA 3RMDA 2FKAA 4MR9B 4DSKA 5SWMA 4NYNA 3AO4A 1Z2DA 5C5EA 2E4WA 2ID7A 3OQNA 1KVAA 2E4XA 4KV7A 1M2EA 3IP7A 4FLXA 4WUTA 3N0RA 3VQ9A 1T2RA 3NAEA 2RJOA 1QP4A 4ML3A 4OGCA 3L8BA 3SZ2A 3O6EX 3HP6A 4EYQA 4KHYA 3N8IA 4J2DA 2X6NA 4CJUA 4JA2A 4IG3A 1ZBHA 1REVA 1T34A 1RT5A 4JB2A 1T7PA 1LBHA 3CM5A 3QNOA 3H5WA 2JB9A 5IEBA 4RV5A 1H9CA 4CIFA 3O3FA 2VWJA 3DOLA 4M42A 4DSFA 4DQSA 3LWLA 4FK0A 1LAVA 4PUOA 1T8EA 4MRMA 4E19A 4RK1A 2G8HA 2EHGA 3EGCA 4JAVC 3I45A 4IMJB 4H4OA 4MYRA 1NKBA 1PHRA 2H0AA 3GRCA 4J2EA 2L17A 1U47A 3LUJA 4OKKA 3I8DA 1MB3A 4FJHA 2DFFA 4B9VA 1ITGA 4MR8B 1ASUA 5HRSA 4CEAA 3U3GA 3ULDA 4HYEA 3SM9A 3ZSQA 1TK8A 1QPZA 2FW0A 2HHUA 3HVTA 4CJPA 3PX4A 3DBIA 1S8NA 3KKRA 2PYLA 2FLKA 4O5AA 1WSEA 1SL1A 3MMNA 4N5SA 5JNTA 2CD7A 2FMFA 1SXHA 2OENG 5EWMA 2D5RA 5CNIA 3LUKA 5KQMA 3NGZA 1EAYA 4KO0A 1SL2A 1GOCA 3SQ2A 4CGFA 4YP9A 1VRVA 1OXKB 2QR3A 3JTEA 4E3SA 1LK0A 4RW9A 4Q6BA 1RPJA 4RZSA 2PUGA 2ZE2A 1D9FA 1JXEA 4KHWA 4W5RA 1SV5A 1C0UA 1JH9A 1LJUA 3RVPA 4KHNA 2NZUG 4PQUA 3EAFA 3K4HA 4DTUA 1EWVA 4HNSA 2FBVA 4KI6A 3EYZA 3QLUC 4ICLA 4CE9A 1KMIY 4N56A 4CJRA 5HSGA 1L5UA 3ROTA 4CCHA 4M3XA 1T03A 5EWLB 1RDDA 4DTRA 4AH9A 1NJZA 3OVNA 4DQDA 6ABPA 3TO5A 1F51E 3QESA 3ISNC 4RDCA 3DLHA 3TAFA 1KTQA 4FJNA 3LMKA 1D2AA 4OPKA 2HHVA 3NF6A 1JLKA 1Z17A 2WB4A 4NGCA 3E3MA 1VSMA 3OQOA 5EWJB 1SUQA 4B8AB 4OKEA 5TQ2A 4AILC 4XAQA 3LP3A 1BL3A 4G1QA 1WSIA 4RSMA 1NXWA 4F12A 4CIGA 2ZWMA 4LE1A 2RKIA 5KTQA 3CS3A 2PZSA 3MEEA 4M3RA 5FWXA 2LUOA 4NGBA 3GBVA 4YWHA 1J5OA 1KRPA 4Z4IA 1VKRA 4LE2A 1C0MA 1L3VA 1B9FA 2XY5A 3BILA 4G0PA 4RW8A 4QICA 4M88A 5EWLA 1XHEA 1QE1A 2Z1JA 2QKBA 3KD1E 3GV0A 3VQ5A 3KG2A 1BA2A 1VRTA 1JLFA 1KLMA 4DQRA 1PNTA 3AVMA 4N47A 3KKEA 5CZ2A 2IPAB 4PZ0A 5TQ0A 2IOYA 3KD5E 3AVCA 1LWFA 1S5JA 4IGAA 4KREA 1U2PA 1QO0D 2IAJA 4LSNA 1A2OA 4LD0A 2R47A 3NF9A 3RVMA 3CG7A 1YTAA 2XO7A 1NK9A 1RXIA 4CJLA 2IDOA 4GW6A 4DS4A 4D6XA 2KZZA 1VPWA 1LWCA 2DFHA 2AJQA 3DRPA 2RGYA 5KRSA 2PL9A 2HNDA 2G8IA 4AHRA 2MYPA 2FXIA 4EGSA 1J54A 3D8UA 1LW2A 4CGJA 4N03A 1EWKA 1YS7A 4NICA 1BI4B 3VQDA 4G0ZA 4M41A 3HPGA 4CJ3A 1B92A 3OQMA 2GV9A 3PO5A 1YMUA 3M8RA 4G0OA 3SPZA 4EZ6A 1BHLA 3TWHA 1DCFA 3KTOA 4JRQA 3GYBA 1YS6A 4EUKA 5HQJA 4DG1A 3URMA 1UOCA 1VSDA 1ZVVA 3T38A 3QIRA 3OYCA 4CJKA 3F73A 4MS3B 4KRFA 4MFBA 2Y1JA 1UA1A 3KTQA 1TGOA 4Z4HA 1ZBLA 5IC5A 5JNVA 3LUDA 5ED4A 1CYEA 1A5WA 1CXUA 1CZ9A 3HM9A 4B9TA 4ZYLA 3KLNA 1XHFA 3C6QA 4CEDA 4JASB 3LANA 3QK7A 3AVNA 3KLFA 4PE5B 2XFMA 4W5TA 3ZSZA 2F96A 2VG5A 3OYEA 1U49A 3ZT3A 4DLEA 3MQ4A 2ID9A 5E41A 1MB0A 1J9AA 2RDMA 3C6UA 4XARA 3EY1A 4CK2A 1NK0A 3O2SB 4HHTA 4RW7A 3AO1A 3KIOA 1UDRA 3B2NA 3QEKA 2QVCA 3B6OA 3L2UA 3OYMA 3V1RA 2WJWA 1PEAA 4DF4A 4RK4A 4DQIA 1IO2A 1RT1A 3RVJA 4Y9TA 4DFMA 4GNRA 4NV3A 5KQGA 1GOBA 5FBKA 3ZSYA 4S04A 1S1XA 3Q7SA 4Z4EA 3OS1A 4PICA 2P5OA 3M8QA 2DRIA 5KQPA 2CHFA 3MXMA 3OS0A 4PEVA 4TN5A 1RZRD 1BCOA 4CHOA 5FWYA 3RR8A 2CWDA 5CY4A 1I39A 2Z1GA 4IKFA 3DZDA 1FKPA 3JS5A 3ZT1A 4XLTA 3FMVA 4E7OA 5JNSA 4LH4A 4BE0A 3CZCA 1PUXA 2B4AA 3TARA 3H6HA 3OJUA 5DMRA 4RXUA 2P5GA 1E6KA 4NCGA 4RKQA 1GCAA 1RBTA 4Q0BA 1A5XA 1DTQA 4JOQA 1J53A 2KYRA 3KK3A 4QOZB 1R4KA 3CM6A 4FXDA 3LDSA 1LBIA 5TQ0B 3VQEA 3ZT2A 5FROA 1WLJA 2E4ZA 1RT6A 6CHYA 2ETJA 3DRSA 1CXQA 3L3UA 3VQPA 3LP0A 2HJ9A 1C4WA 3TABA 1B00A 3KYIB 5TPWA 3CRNA 4CFCA 2E4UA 1Q9XA 4O0JA 3OMWA 2RF2A 3KJXA 2QU7A 1KRWA 3RMBA 4RK6A 3QLVC 4DLGA 4FJGA 3Q7TA 1CEYA 5KC8A 1VSFA 3HP9A 3V9UA 1S9GA 2NUBA 2OPPA 4MS4B 5HM6A 3V1OA 1D9DA 5T7BA 3IRXA 1RT3A 4CEEA 4CFAA 5TE9A 4DU4A 2I6FA 4E7HA 3RMAA 1RTIA 1JFVA 4YLEA 4KI4A 3TX6A 3K2PA 5BRAA 4F2SA 5J1EA 4CF0A 2A1SA 1NK8A 1A5VA 4AHVA 2JLEA 1JDPA 2XDYA 3N6VA 2A9OA 3LUHA 3DLEA 2JGUA 4M45A 3VQ8A 4F3TA 3HCWA 1X9MA 4P1ZA 1HYSA 4B08A 3TD9A 3CYMA 3IPAA 1U4BA 1JF8A 4AHCA 3ZSRA 3HEBA 3O3GA 1HQEA 3EQ2A 5GOTA 4CF8A 5TPZD 4Z0UA 2YNIA 3CTPA 1DRJA 1RXEA 4FLWA 1Y97A 3E01A 4MQEB 3AA4A 1CZBA 3OS2A 4P98A 5HKOA 1VLZA 1DZ3A 4KK4A 3UUGA 4FW2A 3NNNA 4CJFA 1F4VA 3QERA 3GT7A 1L3SA 2GKGA 4FE4A 4KQ9A 3C97A 2F8SA 2TMYA 2JBAB 2E4LA 3RVSA 3QEMA 1M5UA 1HNIA 1Z18A 1R8JA 3CHYA 2PMCA 1M5TA 2VUIB 1X9WA 1YTUA 4DSLA 4E7KA 3KK2A 1Q9YA 3NHMA 3NHZA 2HQRA 4HNQA 5B3JC 3VQ4A 3NGIA 4YGXB 1URPA 1LJLA 1KVBA 4MR9A 2FQXA 1D1PA 3K5MA 4TLMB 4BWJA 1EXQA 5J2NA 4K8ZA 4RWEA 5IX8A 3O7VX 1P8AA 4Z9AA 5ABPA 4D6YA 3NFAA 2I5JA 3RRHA 4RS3A 3M9XA 4I2QA 2JRLA 4DS5A 1TKDA 3RQIA 2HSGA 1SKSA 4M3TA 5KGXA 2FFLA 3SUPA 4KKOA 1HNVA 2D0AA 1ZH2A 4DMNA 4E7LA 3I42A 1O1WA 3KHTA 2LPMA 3S9HA 3C94A 3H5IA 4FCYA 1TVMA 4FM1A 3OYBA 4HNRA 1BISA 5B3JA 1PEYA 4YV7A 3HSYA 3SPYA 1HPZA 5K14A 1TLFA 3VN5A 2GBZA 3JVDA 1MIHA 1ZAYA 1FQWA 1KCFA 5CYQA 2FN9A 1J56A 1NK4A 3ITHA 3NF7A 3MEDA 4YCSA 4Z4FA 1S1UA 2FMKA 4PY5A 1TAUA 4H4MA 2YKNA 3HYFA 4EVQA 2IDMA 3AO5A 2PL1A 3H5LA 4FJXA 1K68A 3KLEA 1BIZA 4FM0A 3CG0A 3DYAA 3AA2A 3VQCA 4CERA 1EETA 1VSJA 3THVA 1YIOA 4KTZA 1WETA 2HB5A 3F6CA 1GLGA 1NTRA 4O4GA 3L2WA 4IG0A 3CQ8A 1DBPA 3H6GA 4WZZA 5DGCA 4PYRA 4Q7EA 2PY5A 4JS4A 1Z2EA 3P1GA 2NT3A 3JSMA 1JKHA 2GWRA 3LWMA 4ID1A 4M3YA 4TSXA 2H3HA 4F4KA 3OLYA 3OYKA 2O20A 1USGA 1JWLA 3EODA 5EU7A 3MIZA 3HPOA 4LRQA 3ILYA 3M9WA 3D0PA 3L2QA 4LZLA 4FJ7A 3C3WA 5C5CA 3EJWA 3O2JA 3Q7RA 3EDCA 1LAWA 4Z9BA 2HQOA 3FFWA 2HPHA 3HXMA 4IRXA 1M2FA 3JVIA 3LUGA 2YKMA 2X74A 4HUEA 2PLNA 1FFSA 4J2AA 4NCBA 4MR8A 4I9QA 1UA0A 1A04A 3K5NA 4CJWA 8ABPA 3LAKA 4NH5A 2FLWA 1BDHA 2YNHA 1RT4A 4KB1A 3KKSA 3HV2A 3NH0A 3UIQA 3S99A 3BRQA 3QO9A 3M8SA 2FC0A 3WNHA 2X78A 5EWMB 5GQSA 3A10A 3IPCA 3CFOA 1MAVA 4JB0A 3T8YA 1E6LA 3H1GA 3S3OA 3VQBA 4QCLA 1RDCA 1VRUA 3QINA 2A9PA 9ABPA 3VQAA 4N0QA 3CKMA 3T6KA 4MS4A 4EP4A 2W42A 1CHNA 4KB0A 2VK2A 1TJYA 4FJ8A 2E4YA 3AVKA 2MYNA 4ELUA 4RKRA 4MS1A 4HTUA 4MS1B 1KVCA 4EYGA 1D4ZA 4DTNA 4CJVA 1NXOA 3M8PA 1QMPA 3LAMA 4ZTFA 2B1JA 2RN2A 1R6ZA 3QELB 1RTDA 4RY0A 3OLWA 3BREA 1U04A 1QSSA 4MS3A 2G8UA 1USIA 2PKXA 3F6PA 3KJVA 2EX3A 1YMVA 5KQLA 2VYCA 3V1QA 3E61A 5JS2A 2OZSA 4LY7A 5IUNC 4DN6A 3U6FA 1SI2A 3AVAA 4FYDA 4LSLA 4MR7B 4LDZA 2G8WA 1IIBA 2IC3A 3HDVA 1U8TA 3LALA 1SI3A 1C0EA 2R7YA 5DKFA 3LTEA 3OYLA 4RXTA 1ZH4A 1IKYA 2KTQA 4Z4CA 4MLCA 3M6MD 4G0QA 2E6MA 4OGEA 3K9CA 4O1HA 3QEXA 3JPYA 3HT3A 4CK3A 4KFBA 2B5JA 1IKXA 1FSPA 3H1FA 1U0SY 3AV9A 4NYFA 1JFTA 3LPTA 3RWUA 3K5LA 5TQ2B 2OPSA 3NF8A 3IAYA 3LZIA 4QPJC 4RW4A 3U3YA 4Z4GA 1WAJA 3QEVA 4CF2A 4M3ZA 2O4IA 4ETIA 2FTKE 5BQ3A 1DCMA 1JDNA 2LP4Y 1RZRA 4DFJA 4Y1DA 3EZ5A 3C6TA 2L2QA 2QZJA 1XHXA 4CHPA 3GWGA 5D2CA 3SI6A 4CGGA 1WN7A 1EKEA 1TVRA 3SNKA 4NH3A 5IEJA 4FLVA 1RNLA 1JLAA 4BWMA 3TB6A 4PWDA 2YNFA 3WNEA 1JLQA 4YFUA 4FK4A 3ZSWA 3JYTA 1LV5A 2KW4A 1VSHA 4FK2A 4EZ9A 1NOYA 4MPTA 2PUAA 5C42A 5TPZA 4AHUA 3ASMA 3PY8A 3OYDA 4OG2A 1Z26A 3SYZA 3I5AA 4TMYA 4LX8A 2OPQA 4DU3A 5CNMA 3KLGA 2GUIA 3H75A 2HVHA 2LIVA 3UK0A 3AVLA 1MVOA 2DFEA 4XIUA 1YVUA 3PX6A 3SQ0A 5HRPA 2P9HA 3RVLA 3ZCMA 3HS3A 1XHZA 4DSEA 1QQCA 1QQBA 4NH6A 1RBRA 4ID5A 4DFKA 1D5AA 3PX0A 2YV0X 1U48A 4FJIA 1DTTA 4KTQA 1NATA 1TMYA 3AVJA 5FBHA 3ALYA 4QYMA 4DTSA 5JS1A 3HSTB 3P83D 2JK1A 1RTHA 4FJKA 1GUBA 2IOCA 1BDIA 1QQAA 4GVMA 4ELTA 3V9SA 1B9DA 4BDYA 2WWVD 4GPAA 1ZBUA 1S1WA 4LDAA 3DLRA 4FZXC 2A9RA 4FE7A 2WOMA 3Q41A 4NHAA 4UQGA 4D74A 3OLZA 4EYKA 3NCIA 2OZMA 3O1HB 2O4GA 3PO4A 3KLOA 3C95A 4FLYA 1SRRA 1SXIA 3HVRA 3MF4A 3OO1A 3TR8A 2Y1IA 2HVIA 3HZHA 3A2FA 1BDJA 2MYUA 1HQUA 1KLNA 3OYAA 5C25A 4E7JA 4CIEA 5IUJC 1ZYQA 2PUFA 2VUHB 3CFPA 4Q6WA 3QLTA 4K8XA 3OYIA 1T05A 2RJNA 3KS9A 3NGYA 2X6SA 5DTEA 3TMYA 3R0JA 3K57A 1JLGA 4OLAA 3FGZA 1P2FA 2QW1A 3QIOA 2PUCA 3EULA 2LSNA 3LP2A 3VNBA 4DADA 4MQFB 1CLQA 4CFDA 2R25B 5TQJA 2PAFA 1Q8IA 2XY7A 1BI4A 4F3OA 1TAQA 3O4QA 3KSMA 4FJ5A 4KHSA 3LUCA 3ILHA 1WNSA 3I09A 4DTPA 4CHNA 4G0YA 3SAJA 3H5TA 5CNJA 4J2BA 4F11A 2RPIA 1YT3A 1I3CA 1Z12A 1KFDA 1VSKA 3O21A 3FFXA 4BE2A 3KLHA 3CLKA 3H08A 4IFYA 3L2VA 2FSPA 4KZKA 5JNUA 3G10A 3SNNA 5DCLA 4I9LA 5J2MA 3KCNA 3MA0A 3RTVA 5IULC 3NNDA 3A0RB 2B4JA 3TI0A 3QELA 4RW6A 2M98A 1VSLA 1N6QA 3I0SA 4FW1A 3GL9A 5DK5A 2BGGA 3AVHA 3QIPA 3W9SA 4BDPA 1S6PA 3NDKA 4CJ4A 4CGHA 3WNFA 3KK1A 1Z15A 1JX6A 5HROA 1W0HA 4JLHA 1GCGA 1BCMA 1NK6A 4EVRA 1L5YA 4B09A 3TAQA 2JVIA 1APBA 3QEWA 4MQ3A 3OO0A 2XRIA 3BBLA 4CEQA 4LE0A 4CESA 5HRRA 3RH0A 4MQFA 3A3KA 2R4QA 4DFPA 4WXEA 3OYFA 4HCCA 3WNGA 5JNWA 1GOAA 3D45A 3BGRA 4OPJA 1EWTA 4PA1A 1S6QA 1IG9A 1QSLA 4O1IA 2IYNA 2D0CA 1JL1A 2JVJA 3CFYA 3G85A 4NGGA 3G0ZA 1JHZA 3MYYA 4HUGA 1TM2A 1VK0A 4FJJA 2DTUA 3S3MA 2FMHA 3LOPA 4CJ5A 3AVIA 2ZD1A 1NJYA 2Z1IA 1LWEA 3JY6A 2ITGA 1JXBA 1XWLA 2OYQA 1ZHHA 3L6UA 2A9QA 1ZY2A 2FEPA 4G86A 3SQ1A 2JVKA 1HEYA 1G15A 3IDOA 1Z16A 3CU5A 3RVRA 4C8LA 5I3UA 1JL3A 3LUAA 3IP6A 1Y1LA 2FVYA 4L4UA 3K58A 5CZ1A 5BR1A 5HRNA 4S05A 4JS5A 4RXMA 4IF4A 3N0XA 4AHTA 1K66A 1NJWA 4E1MA 3OYGA 2IPMA 2WONA 3ZT4A 3CFRA 1MU2A 4QAGA 4MR7A 2KFNA 4CF1A 4WT7A 2OPRA 1NJXA 2LBPA 2Q3SA 5CNKA 1L3TA 2E4VA 1XI1A 4CFBA 4EP5A 1WSHA 3O3HA 2D0BA 4XASA 2CHEA 1DJMA 3AO2A 3NBMA 4L85A 1NK5A 4MGEA 4EY3A 5TPWB 3DGFC 3V9WA 1QO0A 1KRXA 1SL0A 1QP7A 3NHGA 4I7FA 1DG9A 2PUBA 4FLTA 3AO3A 2DY4A 1NKCA 2G8KA 5KGWA 4FB4A 4B9LA 4B9UA 5SZTA 3TAMA 3LZJA 4CHQA 4DQPA 2L5CA 4B8CA 4FJMA 1SD5A 2IPLA 4KQCA 3OYNA 2JCGA 4ETMA 1ABEA 3VQ7A 3HJFA 2HNZA 1S1TA 4RK0A 2PJUA 5I42A 1C0TA 4ZTJA 3AA5X 4TLLB 2YNGA 1S9EA 3N0WA 4CJTA 4KHQA 2FBXA 3NBPA 2QK9A 5J2QA 4H3KB 4CEZA 1NXVA 4KAZA 3QEMB 1A0OA 2JBAA 3H5VA 4B9NA 2YHBA 3O75A 5HP1A 1WSJA 3LKVA 3SCXA 4DWIA 2YHAA 1VSIA 4YO7A 1DC8A 4IDKA 3OM1A 4CHZA 7ABPA 3ZSXA 3HO1A 3ZT0A 4ZJPA 1VYNA 1JFSA
chains in the Genus database with same CATH superfamily
4V0QA 3NHBA 2QN1A 3ZC3A 2I1VB 1USVA 4J4BA 3OU2A 3VKHA 2PSHA 2ZSIA 3ZHUA 1ULAA 2FFAA 4ALNA 2BT4A 3O4NA 3T1NA 1PV2A 3BHJA 4RELA 5CHYA 1MO2A 2ZVQX 4BVJA 2VT2A 1JLBA 1NBHA 3OTQA 1JEOA 4YUVA 1PFKA 4KG7A 2CFRA 4W4TA 1HFWA 3AJEA 3V9ZA 4H5WA 2HPZA 1VI5A 2PBFA 3DBOB 1PJTA 3FB1A 3N5CA 1UBMS 2GPNA 3I61A 3H05A 4DYHA 2QRPA 5ALXA 4LW8A 3ZD8A 1N2GA 4QKQA 1L4UA 1A69A 1HE4A 3N2EA 2BJHA 2HSWA 4P7JA 3RVNA 3UB2A 4C6TB 3KV3O 3KHYA 3ENNA 4E1AA 3QUAA 4IJQA 4R9RA 4Z8XA 5CVDA 4BLPA 1P4HA 2XYGA 1PK9A 1F4LA 3A2NA 3HWSA 3PKZA 3IV9A 1VJGA 3N5KA 1IN7A 2J9ZB 2HZ7A 5DHAA 3BDPA 1ZITA 3SC4A 4H8KA 4HKTA 1CKEA 4QLOA 1MO6A 1YAGA 2ZIEA 4J7AA 4KO1S 4GMJB 3PTZA 1IN4A 3B3QA 4MJ3A 1WD7A 4OTZA 2PE5A 4GBGA 4KXVA 2GEJA 3U4MA 3JV7A 3JVVA 2CYCA 2R6JA 4F8RA 2PX3A 4G0XA 3T95A 3W6NA 2VBGA 4OXNA 4Q66C 2WKRA 4WXMA 1WXDA 2C4VA 2VH1A 2WFMA 3EOZA 3IP5A 4JKIA 4BZPA 3H1TA 4YPVA 1SXGA 4U2FA 3SX0A 5K9ZA 3ISTA 1YBAA 4MLHA 2PBRA 3EA0A 4LY3A 4ILEA 3ZNNA 3CC8A 4CM4B 1SBYA 5JOQA 2O2GA 4RY8A 1GUYA 1YB4A 1DNPA 2P9CA 4IXCA 4YNQA 4XIJA 3U31A 5JAIA 2BZEA 1ZNQO 2J87A 3RK1A 2AOUB 3L0DA 4BE1A 3RUIA 5B4UA 4E0DA 4KHUA 3B2QA 1OVYA 3EG9B 2QSJA 1QIMA 2I71A 4M0EA 4MW2A 3QEIA 4ARCA 1DWUA 3UMFA 2FQWA 1X9HA 2MSCB 3K4PA 3M9LA 3G8DA 1RBSA 1U3UA 2ISCA 3QMPA 1L4BA 4H59A 4PZAA 4W5WA 1DX9A 1HLGA 5ALNA 1Z8FA 2G80A 2Q1TA 1E3EA 2CJFA 5HP4A 2Z6AA 2IBMA 3CISA 1DUIA 5C7OO 4F6LA 4TXJA 4B84A 2HNYA 1ODTC 3FY4A 1AB5A 3GW8A 4P84A 5IJ9A 1SUCA 2BMEA 2C7GA 1G16A 4L0MA 5K6TA 5C1OA 2B5WA 2KX7A 4AYXA 1Z4PX 5L9AA 1SAZA 1DQYA 1CUCA 2BFEB 1DBIA 2CW5A 4CF9A 2HWUA 3D6FA 4GQAA 2PX4A 3LUFA 1NRJB 1ZC4A 4OX9K 2EJWA 2PV7A 3IEKA 1XVIA 4FXPA 3UY4A 1BTOA 1DIRA 3HRKA 2GK6A 1X74A 3JSXA 3Q6IA 3IDSA 3MW8A 4YPOA 5A06A 4B4UA 5HE8A 3HSKA 1AH2A 1BGVA 3WTCA 1W2GA 3QHPA 1YRAA 2M1ZA 5CIQA 1U2DA 4N0MA 5F1OA 4A23A 3VPGA 4D7AA 4QODA 1OIXA 1YC2A 3IQWA 5H5JA 3REQA 1FFWA 3B1YA 4IJKA 4Y9SA 3LFUA 5TSDA 1QSYA 5B7QA 5IJWA 3R44A 4JY7A 2GGSA 3N2LA 3WZMA 4L9SA 2ZE7A 1VHTA 3KKNA 1TF5A 2MSLA 4ELVA 2CY0A 3IOYA 3JYQA 3F9KA 3A8YA 3Q6MA 4PYJA 3VO1A 4MWCA 3EVDA 3KQPA 4CK1A 5TB5A 1BS1A 3TTVA 2JDIA 1IPFA 2Q3BA 2J08A 2VNHA 5JMOA 4O0IA 4Z0NA 1UPBA 4R1NA 2FWJA 4QEDA 3DOJA 1S1VA 4Y1CA 3EQZA 5HFJA 5IDWA 3V4OA 3MAQA 1ZGZA 2YWCA 2VYFA 2VJDA 4UMFA 2R8PA 4MJ7A 5JY6A 1AC5A 2PNFA 5IW8A 3U3MA 3UMJA 3HPHA 2C2YA 3ROMA 2YOHA 1PL6A 1E4VA 3N2KA 5FBZA 3DLBA 4ZPJA 2E3JA 1NLYA 3MTEA 1WSGA 4ZHQF 2XRFA 3JPWA 3BE8A 3OE7A 4JEUA 4ZAZA 1VZ2A 3ODPA 2W70A 2DWPA 4C8KA 3BTOA 3BP8A 4BG9A 3EVAA 5CFRA 3LCCA 1J4AA 4QVIA 1HYHA 1FP6A 3DCYA 1BQNA 3QEPA 1Q1QA 3B6PA 1ZGGA 1PLLA 4E03A 4KZPA 4LC9B 5TDHA 3EXHA 5JS7A 1Q77A 3DOKA 2VDVE 3D81A 4PAWA 4PTZA 1HBJA 3VNAA 1SOMA 1UFRA 2FEWB 1G9XA 3FWNA 4G97A 4ODIA 4RGBA 3WG9A 4ARUA 2ZE8A 4YRMA 2QVBA 4MUNA 4MWDA 4R0MA 2VAWA 1MFPA 1N5LA 2UU9B 1U4NA 1S9DA 1RYYA 1EHCA 2XD4A 1HQYE 4KBGA 3U0BA 2VCEA 1QIDA 1QB8A 2CKDA 4KJXA 3A4VA 4KQIA 4XPZA 3K0CC 5T67A 4TSKA 5AK4A 2WPNA 1HMVA 2Q1SA 3N8NA 4DV2B 2IHKA 3VR3A 4CE6A 1T5DX 5LU8A 3RC1A 5CVVA 1GRRA 2I8LA 2CNWD 4GRIA 3MECA 1P74A 1J8VA 3QQPA 4IMRA 3LL3A 1E2LA 1LBTA 1U98A 2VRCA 4EYEA 5EWJA 2AMYA 1QIFA 3WLSA 3DNMA 4R1SA 5PNTA 2YUTA 2ECPA 1ECBA 4FSXA 4GOLD 3EXG1 4FHFA 1JU4A 2I3GA 3I30X 4CU2A 2BM8A 5KB3A 4HUTA 2XI4A 3DEIA 3W5CA 2JFZA 4IUYA 4MMZB 1P5FA 3NTXA 3IUCA 1UMCA 1JYFA 4W5NA 2HBZA 4JZYA 5KVQA 2X1VA 1JBEA 4FR2A 1U2ZA 3R41A 4XUGB 1T1IA 4E4RA 4KXLA 3LP1A 1E79A 4X7BA 4EA7A 3AK4A 4EMTA 3ESXA 1UPTA 1A4UA 2ZBUA 2UXCK 2FG5A 3KVRA 1RHKA 2VSNA 4DV2K 4R5PA 1MVLA 1U8CB 5JPIA 3BIOA 4G26A 2FUG6 5AOBA 3MAJA 3WOVA 3C3MA 3CBGA 4TL7A 2CFIA 4IY1A 4BVBA 1THGA 2XTNA 3F90A 1RQPA 3VA3A 1DI0A 1ST3A 1O95A 3T5BA 4B6RA 4IFVA 2O06A 3BRWA 5A9TA 5CVTA 2WJHA 1ZSNA 2G9VA 4G5QA 3TZEA 5CLHA 2FF3B 3U7JA 4CIVA 4DY4A 1PGPA 2BEVA 2VHQA 3BXGA 5FAXA 1CERA 2NSHA 4Z1MA 3U4AA 5KJ6A 2UXDB 3ZPXA 3KKLA 3AONB 2OXRA 1XRNA 4J49A 5HFAA 1JIQA 2GARA 4P7BA 1ZVMA 4N3CA 3OY9A 1TFUA 1DKLA 3ZDBA 1YR9A 3OOWA 4AJLA 2DT5A 4HLCA 5IHPA 1UBFA 5NLLA 4GOKA 2DLDA 4X41A 1K73O 3DS8A 4LBYA 2O07A 4MA0A 4C1NI 1MX9A 4KMRA 5DHPA 3RO7A 5I6DA 4P93A 3CH5A 1E2IA 4MCIA 2JH8A 2QPOA 4A61A 3OZRA 4FR5A 4O6VA 4QL3A 3T3IA 1P73A 3SYTA 1F8XA 1ZNWA 1QGYA 2ATCA 2FP3A 3IHTA 3ZQKA 1DBVO 3LCMA 5JQWA 5KCZA 3GA5A 5FTWA 4E7PA 1ZRNA 1QIGA 1KEUA 5EJ5A 3EY4A 4BJ3A 1S01A 2ENUA 2Q62A 4YFYA 2PEZA 1UZUA 5DK6A 1KOLA 4MI6A 4YY3K 1DBRA 1JYEA 1QRRA 2H08A 1E18A 1F14A 1GZ3A 2OCDA 2Z4SA 3B70A 3GG2A 3P1JA 5B36A 3PI6A 1OB5A 4AQYK 1JGTA 3A9SA 3NE6A 5E4TA 1L7PA 4BQZA 2O0LA 2JZNA 1XHLA 5ENZA 5I3ZA 1HYVA 3H4MA 4W9NA 2P9KA 2ZYRA 5IH7A 3TXAA 3H9BA 4H4CA 1XZDA 3N6RA 1P0CA 2E6UX 2Y1LA 1M2JA 1NXTA 3H1EA 4KBOA 1MBZA 4G8CA 5C2DA 4X66K 5CW1A 4H3HB 4O2AA 2YVUA 4HWGA 3TLGB 3EKUA 1H6AA 1CQIB 1H0HA 2BIFA 3FI9A 5CLGA 3NW9A 1DO8A 4B6GA 2V7BA 5ALLA 2FFJA 3JD4A 1T8UA 2AFIE 3OAAA 5EXDA 3HL8A 4IVRA 1SN7A 4OKNA 4OLFA 3HI4A 1OE0A 1ZU4A 1XF1A 3MWEA 4H1TA 2HYIC 4L75A 1XTIA 4O0MA 5T41A 3I0RA 2DFDA 4D42A 1GGHA 1P33A 1DTEA 2ON6A 2WWIA 3HEMA 4IGIA 4D0GA 1KVRA 3RVCA 5IM4F 1ASWA 1O96B 2ORYA 3OZVA 4QGAA 5T8KC 1EHIA 1M7HA 2CMFA 5DLEA 3EOBI 4L8FA 1F2UA 4TQ9A 4MULA 1XVUA 1JSLA 3PXDA 1NOZA 1Q3TA 1L7DA 3T94A 5KJCA 3VTAA 3T19A 3O3IX 4WFQA 5H9VA 4Q5VA 3HP1A 4PGFA 3WGQA 4TTVA 1OF1A 1RWBA 4YXWD 3A5OC 1HE8B 2GYWA 1P4AA 1E1KA 3VYWA 3VAZA 2Y99A 2DKNA 2J07A 5E4FA 2NRHA 2OTJN 1KI1A 1YOVB 3GVXA 3PJGA 4RABA 5J5VA 2JCBA 1KZ9A 1Y98A 2QF7A 1CPYA 2I7DA 2WJ3A 4RD6A 3E66A 2FZKA 2YIJA 4D99A 5JC8A 2L69A 1UAXA 1RCHA 2NZVG 1RU3A 4AQDA 4ZVTA 3FYTA 4LHWA 1V4TA 1LOTB 2D0DA 2MYTA 1G38A 2MCFA 1TL3A 3CUYA 3NWPA 3WO1A 1N5MA 4Z99A 4CMIA 5I3CA 2P9NA 4BR0A 2BJVA 3SKYA 3DPIA 5GJBA 4NHOA 2WINI 4OKJA 1XCPA 4BO5A 2A40A 5FOVA 1Q0SA 3WYFA 3RVOA 3RTAA 2VGNA 3G8BA 3OYJA 1RZUA 3PA8A 4I8XA 1K6JA 2HNKA 2V51B 4TL6A 4XYMA 5K3FB 1C8KA 3ZWVA 4WJKB 4WUVA 1SVWA 2EATA 2ZUSA 2ZB2A 4PW0A 1GG5A 1NUTA 1P2DA 3AU8A 5TC4A 3PUKA 3I73A 4IOXA 4IDPA 3MGKA 2YH2A 1NG1A 1P81A 3EWAA 2IZ0A 3HB7A 1JSCA 2FZGA 1O8CA 1CR4A 2E9SA 2VK1A 3LLSA 1PZGA 4D4LA 5H1SQ 4D8WA 2YBDA 3RRGA 3Q0EA 1LDGA 2FEXA 4I6GA 5P21A 4DLYA 3DYVA 3BZWA 3VI4B 4UM9D 3BTVA 5KX5F 2BDEA 3CEHA 1ENPA 2R8EA 1PCXA 4MGYR 4DCPA 4PC6A 1WCV1 5H81A 1P4SA 2GK4A 5AIAA 2FSIA 4ERXA 3R3WA 1D2EA 3DV0B 1KQFA 5KO2A 3Q9LA 4AHSA 1OWOA 3CBQA 4JD2B 3GJTA 2ZJFA 1RWXA 3B6EA 3L0CA 4DIOA 1EVQA 1AKWA 2QJRA 4XUCA 3HZZA 5A0VA 3AJ8A 3GUHA 5C52B 2VWBA 1DPFA 2Q7XA 2ZCUA 1OVGA 3AXTA 3EE8A 1NKTA 3A4NA 4BN0A 5L7TA 1WQ1R 3RT9A 3GBPA 2VF2A 2W6CX 3WRWA 5AP9A 2X2PA 2P4UA 2QVWA 4MDAA 1OQAA 3QB0A 2FPMA 3ZHYA 1U7WA 3L4BC 4X24A 4A8JC 4ZYUA 2B78A 2H9IA 2P9ZA 4UUNA 4YALA 2ZUCA 1FYVA 3N7UA 5BSHA 3BULA 1YZNA 3B36A 1KFJB 3PC6A 4KGXA 2WT4A 3SY8A 3M81A 4LCEA 4QSMA 5JZMA 4B3GA 1ORIA 2PUEA 3VPXA 1SA0A 2NZ2A 1CZRA 1IHYA 1USKA 1R6UA 4IDNA 1V43A 3G0IA 2AJLI 1L7EA 1T6BY 4NEGA 4JHDB 4N0PA 4E22A 1XP5A 1JQEA 1VGRA 1FXXA 1OLOA 3V81A 4HSGA 3RAPR 5TJ9A 4KV8A 4DSIA 5FOQA 5FRMA 5L7YA 5BNWA 3ZI4A 3O1IC 2KFZA 1SKAA 4MTLA 3W5BA 4GX1A 3VEYA 3G1UA 1KDPA 2JIPA 4O55A 3J81O 4BHTA 4RJIA 3G2LA 4C8OA 1SBNE 1ZEMA 4F38A 4P82A 5BN1A 1I5RA 4GLJA 5JQGF 4TWJA 2VSFA 5DBIA 2EBHX 2RGUA 2QYSA 2VPYA 1VQ5N 2XKAA 3T69A 4P4LA 3W8DA 4BWVA 4EG0A 3ZQ6A 1TGYA 4PVDA 1O2DA 9LDBA 4A91A 5TVKA 3G0HA 3VQQA 1MAAA 2QAIA 3PKJA 4B9MA 3VDMA 2R6DA 2MU1A 3LBIA 1U2GA 2ZIFA 4MV3A 2HHHB 2IFTA 1PV1A 1P6UA 4QUGA 4F04A 2HMIA 1OZHA 2Q9AA 1IKWA 3FLEA 3FWZA 2HZBA 2XHBA 3L4IA 2G5CA 2YV5A 3L7KA 5FTKA 2ZTHA 3AY7A 3UFBA 4F4JA 2WTNA 5LLDA 5I5EA 4R69A 1EFDN 2IPXA 621PA 4TWRA 2O23A 3QG5A 1L6RA 3WQTA 3A3OA 3JYHA 4MRMB 2I65A 3TB4A 4NV0A 4D2IA 1X7YA 2VXCA 3OECA 5KVAA 3PLAA 2X2EA 2XF8A 2VP0A 3CETA 4QRDA 1Z25A 2V54A 3QKRB 4FOSA 4HRVA 4JJAA 4NP6A 1ONOA 3LZCA 1P17A 4PZPA 4ZVLA 4RD0A 3TKLA 4E1BA 2QTRA 2QTTA 3KJEA 4WQ4C 2FGKA 1EFVB 3JZMA 3UWMA 4UY8O 5FQOA 4OATA 1MB4A 5BPNA 3GFBA 4V3BA 3QEJA 3U7EB 5HLFA 4C7BA 4CM9D 4NJMA 3DRRA 1KI6A 1OR8A 4X1KA 2DQ4A 3RMCA 2YJGA 1KIAA 1JZSA 1O9BA 2UV8A 1WW3A 1EAMA 1UL1X 3UFXA 4MLDA 3RD5A 3IKMA 3SLCA 3OJSA 3EG9A 2FQYA 3JXEA 4FT2A 5IP5A 3PI7A 5B2ZA 1NPTO 1DBQA 4BPBA 3EQ8A 3ENHA 1R9JA 1NU6A 3LQKA 4PC3A 5J2UF 2P1JA 2GBIA 2J0UA 2VJPA 1QHAA 3U7IA 4YI3A 4ZJUA 3K6SB 1EP4A 3BXPA 3BSYA 1G8GA 3D7SA 5AVZA 4MARA 1QTMA 5J9FA 1G291 3KVNA 4GXQA 1ZH8A 4LJKA 4BP1A 1P9RA 4CGIA 3O74A 4YRAA 3WGIA 5FOTA 3K72B 3IGFA 4BJ1A 4J16A 3UB4A 3OLVA 3DXZA 2RGGA 5SWMA 3AO4A 4BMOB 5C8XA 3ZDYB 3OQNA 1J2RA 3PXAA 3OWXA 2NP7A 1H3FA 4BXOB 5A6SB 4PAQA 2XX3A 4ENQA 4DV4K 3O90A 4GUDA 4IHQA 5KYYB 3PWTA 4FWLA 4G23A 4K6GA 4O2BB 3OQHA 1M2EA 2D1RA 3GFFA 3Q98A 4WUTA 2O1EA 1KARA 3VQ9A 1T2RA 1C1XB 4L7QA 3GCZA 2CK3D 1F2TB 3BH6A 2RK3A 3EGOA 2Q9UA 2RAFA 1OXTA 4DV0K 4KWCA 4Y2UA 3SMQA 3TNFA 1VKJA 2I7PA 2AOWA 2JCVA 3IMXA 2X4GA 3O1BA 3WIBA 2EGHA 4TYQA 3M6AA 2Q7DA 4RBNA 3B6KA 4J2DA 1BCSB 2H1OA 2CNDA 2Q7OE 2WEKA 1ZBHA 2C5AA 5DMHA 1P5RA 4WBNB 1REVA 1KAOA 5I7OA 1JHMA 5M1OA 1LBHA 1SQFA 4BVPA 1J24A 2PQ0A 3OZIA 4REQB 5CDUA 1S2GA 4IIEA 3OT5A 5IEBA 1NN0A 4ZANA 1FDUA 3ZHSA 2CBXA 4MXDA 3ITDA 4CETA 4UBOA 2YJZA 4IH1A 5EQFA 3LW7A 5CT9A 4M42A 1RLJA 4L1UA 4DSFA 1BKDR 1I32A 2VTVA 3D4LA 3LWLA 3H8VA 2A57A 2RAPA 3HU3A 1WHTA 1E8NA 1U1CA 3D2FB 1H9BA 2P5SA 2P9QA 3HH8A 3QU2A 2FR8A 4GF5A 3MWEB 3PNMA 4H3SA 1M9NA 3BB1A 1DEKA 4J03A 4ZU1X 4MRMA 3K6SA 1CUHA 1QO7A 1E4YA 3TR0A 2EHGA 4AKSA 1NR1A 2FDRA 2J9XB 2GZ3A 4ZU3A 4B1VA 4JT8A 2KLBA 3SDSA 4D44A 5LWQA 3BXXA 1X86B 1PWEA 2Z43A 1I3MA 3U7FB 1JHYA 4NBUA 4P0TA 4UU1A 5EJIA 2PWBA 3LUJA 5F1KA 1TC1A 3RKRA 3S2FA 2UKDA 3ETHA 4AUEA 3G79A 4CKXA 2FEMA 4NYMR 4MR8B 3ER6A 3RFCA 3TKAA 5E6RB 1L4NA 1KYVA 1QFJA 1VZ3A 2O3JA 2QRNA 4CEAA 3VKGA 4C43A 4Q02A 2ZRNA 3WGLA 1R5OA 4HEQA 3OEHD 4FLFA 2A8YA 4L7VA 4NAHA 5L3VA 2FSJA 2B36A 2JI4A 2PMWB 3D3WB 3WQRA 1QPZA 5T5QA 1I13A 4G56A 3HVTA 1SC6A 1ZJ4A 3PX4A 1E7SA 1LK5A 2TECE 2A5DA 3BF1A 2VA8A 4OPMA 3NVDA 4P34A 5FFFA 1J25A 4PKGA 1MGOA 1S8NA 2I1WA 2ZBRA 2XSZA 3C48A 3NPAA 5AK6A 3UB3A 4BEVA 4F5EA 5AESA 3A5NC 1WSEA 1A9QA 4PLTA 5C8DA 1JR6A 4KWTA 4N5SA 3WAGA 5JNTA 2C9CA 3U9LA 1MHTA 4KRXA 1NIPA 4QPPA 2QD3A 3QUSA 2OTCA 5DCUA 4EB6B 5TEWA 1TFRA 1T26A 3KSZO 1T29A 1LBQA 3E23A 4OAQA 4JYAK 1FNNA 2ZBVA 1WHTB 3LUKA 5CNIA 2FVXA 3NEAA 4X64B 5EJ2A 1B41A 5FPHA 2CCGA 2VR1A 1DIAA 1EAYA 3EFBA 4W7HA 4Q3AA 4ZQEA 4LOKA 4N54A 4M0CA 2PSSA 4R51A 2P11A 2GBGA 3K2IA 4LE1A 1YONA 1LC0A 1WPXA 3EGVA 3F1KA 3MWLA 4JZKA 4UNQA 4DCVA 3ID8A 2O8CB 1Q74A 2PU5A 5EJFA 1YI2N 1GOCA 1P2UA 5DNUA 4JJ4A 3R8FA 3SHTA 1OXKB 1SWWA 4QUJA 2XYQA 1I5EA 1RPJA 3GJ6A 1T8SA 4FVTA 2PUGA 1TVKA 1X3SA 1K8KA 2HA4A 3CR3C 2Q27A 5JI3E 3AMVA 1YKGA 2GXQA 5AZJA 3E9QA 3Q85A 2FWMX 3MJFA 1BG6A 2Q6TA 4IJNA 4ENSA 2DERA 4MVJG 3DEHA 4URFA 4WERA 1LJUA 1WVIA 5AXCA 5DTRA 3RIYA 4R2XA 2PKWA 3OPYA 4DTUA 1XTTA 3IS3A 4CMEA 3JQ8A 3UG7A 2GEKA 1TL7C 2O2EA 2PGOA 3PKIA 4YMVA 1XXHA 4ICLA 4CE9A 3M5DA 3H0EA 4HDAA 1IONA 4II3A 3VU9B 3ZE8A 4N56A 2P6MA 4PGAA 4LYJA 1YZVA 4ZN6A 4AM6A 3AILA 1YXQA 1TKAA 1Z37A 2IIBA 1M90O 1V3UA 4NCNA 4RF2A 3SFTA 3U5ZB 2NG1A 1SZ2A 2C9BA 5CGZA 3RHZA 3F6YA 3I1FA 5DP1A 4B73A 4D80A 4JD5A 1U6IA 1NJ5A 1EE2A 4KUHA 4UXIA 4MI9A 1XMSA 1Z68A 2QX4A 5JANA 2XMDA 4HQ0A 4ZAFA 2BP7B 1Q6ZA 1X3MA 1YMQA 3QESA 1G7RA 2W8BA 1OILA 1BWSA 2A88A 2VPPA 3OETA 4X0EA 4NZNA 1KYQA 3UJ8A 3GEPA 1FSGA 4FJNA 3LMKA 3JZDA 1TJPB 4R8MA 2HRZA 4XRRA 3U4HA 5L51A 1X87A 1RWWA 3WXMA 4A4DA 1YASA 4XWAA 3TNDA 2P3SA 4DTCA 1UOEA 4NHEA 2WVJA 1TUUA 2DHEA 4RH0A 2CKMA 1FX1A 2E4AA 3RSQA 4BJHB 4HBGA 3AHCA 4Y2JA 5BSFA 4HFRA 4YRTA 1XCBA 1DAPA 1FYXA 4GLOA 1HFKA 2DWUA 1P4JA 4W6QA 4X1OA 2ZUVA 5CVJA 3DMRA 4V19S 1U6JA 2X0JA 3TLXA 3KVGA 4G1QA 4FGSA 4RSMA 5FO0A 4BCBA 4C08A 3AI3A 2LNDA 4DUZK 4F12A 4IGKA 4JKAA 4ZAGA 2NPOA 2H48A 2YMLA 1C1DB 3N2KB 4UEJA 2J0SA 5KTQA 3G3EA 2A1IA 3CS3A 3SC6A 1PR0A 4G01B 5FWXA 1SOAA 4NGBA 2G0NA 1Q18A 4OQXA 4YWHA 1J5OA 2J3MA 1YH3A 4Z4IA 2FPIB 2OP1A 4AM8A 5CA1F 3VPAA 1SCUA 4JT2A 1J7KA 1XEAA 4JI7B 2Z2KA 2JGDB 4XM0A 3OJFA 1RQRA 4EX6A 5AKGA 1B9FA 1ORTA 1PQYA 3OTHA 4UDNA 4EABA 3PDIA 3ZV6A 3NBAA 4QICA 2UYGA 3H2GA 5A5VA 2PXAA 3ELBA 1WB5A 1QE1A 2Z1JA 2V1UA 1W5AA 3KD1E 3NC0C 3S1LA 2JJYA 1QZXA 2WJ4A 4KIFA 5EEGA 1SQ0A 3OPNA 1TO1E 2BMDA 3OFND 1P31A 1ORDA 2NZXA 2OSBA 3PNOA 4JUFA 1VRTA 1P91A 2IYYA 4OSEA 2QWQA 1G7TA 3SS8A 4BRUA 4A03A 3ADCA 3DMYA 1MABA 3NM6B 5CB8A 1G20A 2V7UA 4QRHA 1B8PA 5TQ0A 3AVCA 4ZOEA 1DT9A 2XUDA 3J80O 5J4YA 2YWXA 3WLFA 1V7PC 2AJ8A 3OESA 5EXWA 4JNEA 3QFCA 4D6PA 3NXSA 2PZKA 4LD0A 2CL5A 3NF9A 3P39A 1LQ2A 3WUHA 1XZBA 3FNQA 2HF4A 1C0PA 1QTRA 2VSXA 4MYHA 4BC1A 5D1NA 2PT5A 1YTAA 3ROPA 3SJBA 1NK9A 1RXIA 2WU8A 3HDJA 3IP3A 4JITA 5MFPA 3DYIA 2BGJA 5F7ZA 2HHAA 5HE9A 3D0KA 3H4IA 2YX6A 4GW6A 4DS4A 1PR9A 1XKXA 3GVPA 1QUEA 1XKLA 3KQSA 4QQ8A 1LWCA 3ZGVA 2DFHA 1ZNXA 3TZQA 2G1AA 4W8HA 4Y2RA 2RGYA 4CPDA 3WQUA 4GM1A 1RHUA 4JSRA 1RRFA 1Q82O 1VPDA 4K86A 4RHYA 1M34E 2D5BA 4IHKA 2X23A 4ZAYA 3V3KA 1N78A 2PA3A 4NPAA 1MP0A 1XDDA 3CNLA 3NASA 5A3JA 4BFLA 2CLEB 2HAEA 3V4RA 1OFHA 2QXLA 1LW2A 2V7XA 2B61A 3QFSA 5CLFA 1UIRA 5BUCA 3PUWA 4NICA 4J1TA 3AUSA 4EATA 1D4FA 1Z4KA 2DTDA 3K9BA 4GFDA 2ITMA 3HKDB 2ERCA 4EKDA 3IR6A 3AC0A 1FF9A 2ZOSA 4HH1A 5CBPA 5K3AA 5HRCA 4MKZA 4J1TC 3HKEB 3GPDG 3A37A 1RWOA 1JWAB 2BFOA 2GV9A 1Z2AA 2RHKA 3MTGA 2EQBA 4GPD1 4N7BA 4PQRA 4Q9KA 3TL6A 1VBNA 4CL3A 3D2FA 2AG1A 3E8SA 4Y0AA 3O9SA 2I78A 1OYVA 2V7WA 4Q4DA 1IHUA 4G0OA 3CCCA 3QIVA 1BHLA 1NGBA 1NZJA 1ZIDA 3MRXA 2DUUA 1E5VA 2FPGA 1GTRA 3EA4A 2OK7A 3Q5DA 4GL4A 3ONFA 1FNCA 4NK5A 4QUDA 1ID8A 1OX5A 1MJHA 5HIIA 5KDDA 2W37A 2ADFA 4WFKA 1V26A 1XU9A 2IQIA 4B3RB 4TV8B 3GYBA 1ID1A 1YS6A 4KQMA 4TTIA 4EUKA 5HQJA 3CCSN 3K0HA 3ZDXB 2PK3A 3I1YA 3URMA 4ERNA 2G4VA 3HOSA 4IO9L 1VSDA 3P2YA 3PCXA 4QBKA 1ESMA 4YFVA 5UKDA 1PKXA 1Z5WA 2AG0A 2PZBA 1SXJC 1FFXA 1UJMA 2YHXA 2XB4A 5CDFA 1M8PA 4F6CA 2ZIGA 1X80A 3WWEA 1IOVA 2W6IA 3V46A 1XQ9A 1YITN 3G9TA 4CJKA 1KVUA 3C8HA 2ZYGA 4L6IA 2XVZA 4A0SA 1VL1A 1OGYA 2WILA 3AHJA 4N7RA 1X9GA 3WLAA 3NCHA 3R3SA 4CQJA 2EQAA 2XNSA 3AIKA 4MS3B 3IJEB 3RS0A 1G4HA 4U9UA 3NR2A 3WDKA 1C29B 3P4YA 4PTLA 5EC8A 1R0XA 4A5AA 4EGJA 1OYYA 1V25A 2FMXA 3ND5A 5K6AA 5IC5A 4OOFA 3RS9A 4DV3K 1A5WA 1FDVA 1KAGA 3L0IB 1C2TA 3HM9A 2BFBB 4JLKA 4XQGA 3ZTWA 1GGMA 3T1QA 3ZLTA 1BFDA 4K6HA 3UWPA 3PLAE 5A3QA 1EB8A 2HY7A 3HZOA 1L5GB 1Y0BA 3DCJA 5JLHA 1HQCA 3C6QA 3NG1A 2ZJ5A 4RKWA 2QTHA 4O4IF 3JWHA 3FMPB 4UC0A 2BHRA 5HTKA 1O94D 1QHYA 2F4NA 1XPUA 1N33K 2EERA 2WTEA 3FKQA 4JC8A 3QK7A 3AVNA 3KLFA 4FJ0A 4E1JA 1LF0A 3G2JA 4YV0A 3ZY4A 1SHTX 4FYYA 3VEZA 3AUAA 4RA6B 3ZSZA 3R7FA 3SR0A 4O1MA 4CZMA 4P7KA 4F5WA 3DEZA 1SC1A 3KL2A 4DLEA 1TB4A 2C3MA 2VHVA 1MB0A 2MR5A 2O0KA 2RDMA 2F9MA 2R1VA 2V65A 4OM8A 1J1UA 1PF7E 4BO4A 1SC9A 4TXHA 3HABA 1H5NA 4P58A 2V7QA 4RW7A 3AO1A 4R5HA 2QIOA 2GUGA 3RYHA 4HOYA 5DBOA 1MW8X 2WSMA 3W79A 2O8DA 2BKAA 3DWIA 4M1TA 3E9OA 4Z86A 2FP4B 3HTVA 4G2TA 3B6OA 1W19A 4IOJA 5JO0A 2IXBA 2R97A 3C5WP 2A9JA 2WJWA 4M38A 4B3TK 1GEGA 3TRFA 3VVBA 4DF4A 2PFGA 1NQTA 3P4XA 4DQIA 4RK4A 3TL2A 1IO2A 1ZUIA 4C0AC 3QSGA 1T1RA 4UOQA 1CEQA 4U7PB 3RVJA 1V4NA 1WXEA 2Q50A 4FJ2A 4JJFA 3CM0A 5HCIA 3W9YA 5IC4A 3NO4A 4Y9TA 4YCNA 1SQGA 1YB6A 5IS2A 4YJDA 4DQUA 1FSZA 2Y1WA 3LNTA 2GLXA 1VHWA 3KQUA 4LYEA 2RGBA 2WJYA 2BGIA 2CXNA 1J6UA 4GWLA 5IKEA 5KQGA 1R4NB 4DW8A 3IRUA 4S04A 3OI7A 1W4CA 3V2HA 1L5HA 4P38A 4BN4A 2A5GA 1JPVA 4PICA 4O33A 4K26A 1U0OC 3MPOA 1U7DA 4TQAA 3WYEA 5KYYA 1VECA 3DXFA 1MGPA 1W85A 2ORVA 2PT7A 1VAZA 3ATVA 1E69A 2YV3A 4FEGA 4KXUA 4N9QA 4DCNA 2QX9A 2CHFA 2HNAA 1UZLA 2W11A 2BLNA 1OC2A 3AAPA 3RJMA 1BJKA 3DXKA 1I2BA 2Z5GA 3ESYA 5GP1A 3T7AA 1T9AA 5F9FA 3G89A 4MW0A 3KOOA 4RPKA 1DX6A 1HYBA 4XWTA 4LXIA 1DGKN 1VC2A 2EFCB 5GIPE 1CNEA 4FWMA 4CHOA 2IU6A 4KQXA 1T2AA 4MSUA 5GVRA 1FXUA 2HMWA 3DQPA 2ZI6A 1CDOA 2ZRDA 2CWDA 4DCSA 3ZVKA 1Y6QA 1E0DA 3VNSA 3NYRA 4H1HA 4ON9A 2Z1GA 3U4IA 4DNQA 3EDRA 1DZIA 3CKKA 3T34A 4L3QA 3ZT1A 1Q7CA 5C1PA 3D6MA 1YD7A 2DU8A 2GNAA 3WSWA 3BJIC 4RL6A 2I2WA 5EKSA 4E7OA 4ZTZB 1ADGA 3AB7A 3SLGA 1M2VA 1ZW1A 1FZQA 3EK2A 1LCIA 1WY5A 2PZEA 3L0YA 1J9EA 3TARA 2ZTSA 1F5SA 1Q0RA 2BSXA 2QS9A 3IJRA 1HSOA 4CF4A 3CX8A 1HMPA 4DGSA 4BQIA 4ARBA 4B75A 2I3BA 2GN0A 2I99A 3DD5A 1ND6A 4IQGA 5CFQA 5IZCC 3FSRA 1Y7IA 3HBTA 1V47A 5DWVA 3SOZA 5ALHA 2A86A 3STHA 2HM7A 5G0TA 3UUEA 3C6KA 4JUCA 1RJGA 1EFVA 1NSTA 4Y1FA 5FYDA 4ZVRA 1CUEA 4Q0BA 3QVGB 4ILKA 4CKWA 2PJRA 2F43A 5JARA 1X2BA 4LA4A 4MKXA 1G55A 2C9MA 1OXXK 5BT8A 1G20E 1BO6A 5JH7A 1JR3E 1OWNA 2C29D 3TGWA 4QDXA 1KETA 5I9EB 4PFQA 1R4KA 3NPMA 1QFZA 3NANA 2JASA 1OT3A 2X40A 1YCHA 3PX2A 3AHEA 1S7CA 1Z3IX 3CN9A 4PY2A 3QVJA 4K6MA 4ZXPA 3LOQA 4TL8A 3SF8A 3ZKWA 1O1YA 2XB9A 2B3DA 4RGQA 1G8HA 1ONBA 3HJGA 3C0KA 3A14A 5TQ0B 4KLCA 2QYTA 5FROA 3DTVA 1MOSA 2I2BA 3W8RA 1AK1A 2BGRA 2IY7A 1LI5A 2GX9A 4FHCA 4XR4A 5C5DA 6CHYA 2ETJA 1LVHA 2CEKA 3DRSA 3EARA 3F6EX 5B1IA 1U8EA 3E4DA 3U80A 1MOZA 4CNQA 1P5HA 4FFDA 4AKHA 3GAMA 3OF2A 4GBMA 1KA9H 3GLIE 2HDNB 2JEYA 1RYFA 3L3UA 3E15A 1VMAA 3HWWA 3MRVA 2HV8A 4MDHA 4O3MA 1TTQB 4JA0A 4NYJR 4ZRDA 4E21A 3TABA 5HF8A 2EC5A 5DTJA 2PZAA 4LVCA 2B6HA 2QRMA 2OV4A 3F7TA 3ONWA 3PIDA 2MINA 1M2WA 3PHCA 4OOEA 4R6XA 1Q9XA 1HE2A 3SYKA 1KAMA 2VFAA 2VP3A 1HDRA 3OMWA 1ODFA 3R5XA 1ZC6A 1SG0A 1QTIA 2VSQA 3QJ5A 1E1QA 1EI9A 4FMCB 1GILA 4OGKA 1KZ6A 4QREA 4ZYXA 3SD7A 3KNZA 4GYYA 5ELZA 4LZJA 2QU7A 4RDXA 1F9AA 3ZIAD 3AF5A 2I22A 3QPBA 5LR6A 3AM1A 4B3TB 1XDWA 3C8ZA 2P0AA 5JJ5A 3U4LA 4ASUD 1KDRA 1E6WA 4RD1A 3RV3A 1X1DA 2PSDA 1Q81O 3BMOA 3VC2A 4CFYA 4OL0A 1VSFA 2GF0A 4K2AA 3VYSB 5EI5A 3UHJA 3B5EA 2H92A 2Y68A 3LPMA 5FI0B 2NUBA 5KU7A 1VIAA 4GPBA 5BN3A 3WI7A 4X00A 5AM1A 4L5JA 1GTG1 3HJRA 1LDNA 1MW9X 4MA4A 5CDTA 3V1OA 4V0SA 1DC3A 1NRIA 3N8KA 4AC9A 3VZPA 1X7HA 5J2UA 3NMUA 1M73E 2QDKA 5JQGA 4MKRA 1CD5A 4CFAA 1IN5A 4E4TA 2NTYC 1M66A 6ADHA 1JJAA 3ZHCA 2WHQA 5AQHA 2A5XA 5EQDA 4K9PA 1U7OA 2VDWA 1JFVA 3BB4A 1UT8A 1CLEA 4NBRA 4A62A 1NVKA 3OCWA 4CM7A 3FAKA 1QQ7A 1AGPA 2P4QA 3CJ1A 4EMBA 5KOIA 1AQJA 1UPXA 2P40A 1U8UA 3K2PA 1ZX1A 4M2LA 5DFAA 3PGLA 3UV3A 2C9ZA 3E5MA 1RDUA 1D2CA 5EE5B 1VQNN 1U4OA 1E1RA 1X7WA 5GZ1A 3BMXA 3ENQA 1IZ7A 3QFTA 3T4UA 4B3CA 4CF0A 2HTEA 3PT9A 3VSEA 1FTGA 2XF2A 3VHXA 4EHKA 4KRYA 1PT9A 4DZZA 4AHVA 1S5PA 2ODTX 3IDQA 3B1VA 2C7RA 2JFHA 1JDPA 3EY9A 3MOSA 3N6VA 5T57A 3T7TA 1OH7A 4Y6GB 4WY2A 2VJMA 2IYOA 1II8A 2IXEA 1T24A 3L9WA 3VQ8A 4F3TA 3SS7X 3HCWA 4JGIA 4PBRA 4P1ZA 3ZVNA 4C4XA 4BLVA 3OQBA 5JU6A 2ZJ6A 2G9UA 2MTBA 3VTZA 2WWYA 4YO8A 1G3UA 2QRJA 3TMKA 2GKSA 2UVPA 4BV3A 1T2FA 1YS2X 1XYYA 3OC0A 3UKOA 4ZIRA 3MBOA 3QXJA 3LHKA 4CKBB 4HAVA 4IZIA 2WAYA 4MWBA 3T7IA 1EG2A 1QH9A 3AGKA 4M0UA 3P0RA 5AUNB 1CUDA 3BORA 2YNIA 4URYR 2II6A 3T1YK 3ZE7A 1EXNA 2YZKA 4NZZA 1K7SN 1GQ2A 1I2DA 1Y97A 1YQTA 2W2XA 4QX6A 1XN1A 2QVLA 3IMCA 4QM7A 1U0HC 1CZBA 4R8KA 1FMFA 2DHDA 2ZKIA 2OHVA 5HKOA 3U61B 2I03A 2GCEA 4IOMA 5EQTA 1U8YA 2FWAA 4R3WA 1JDSA 1K4MA 3RC9A 3RRNA 4KK4A 2VPIA 4FW2A 1T6XA 5F4ZA 2BYTA 4MUYA 1KMNA 4E5VA 3U1TA 5BUQA 2RIPA 3P4IA 2GM3A 2R1VB 4CJFA 1X7DA 1XVVA 9LDTA 3ESAA 4QUHA 2XYRA 4FQ8A 1AQNA 1DKMA 5LP6A 4KQ9A 3Q3VA 4MRRA 3CF4A 1WA5A 3K16A 2Q0RA 1GUAA 1Z6QA 4BEBA 1HT3A 2TMYA 3B85A 8OHMA 3DXYA 1CQIA 1RXUA 3HMKA 4JI2B 5HS6A 4MUIA 1XMPA 1YCGA 1R64A 4H3VA 3RVSA 4XR9A 1M5UA 3VH3A 4CVNE 1HNIA 1CZUA 3BGVA 4E5PA 1R8JA 1T13A 2JAUA 4GKJK 1MEEA 2W7TA 2ZSAA 5JADA 1M5TA 2IF0A 1ZN7A 3FFKB 1YTUA 4I9NA 4DSLA 2VUUA 1YF5L 2O6LA 2VYQA 3E7XA 2LKDA 3AEUA 5ER6A 4LF7B 4LF8K 1Q9YA 3EISA 2J9YB 4JS0A 4OD0A 2O7RA 1PTJA 5E9QA 5IAGA 4YGXB 4FDTA 3OIFA 2BFCB 2P1ZA 1KVBA 3FJOA 4FW8A 3OURA 1BSVA 1KMHA 4TLMB 5GTDA 2BTEA 1J22A 1FP1D 1TZJA 4BWJA 3PFGA 3RPEA 1FW6A 1IXZA 4NECA 4ZOLA 3DA5A 2QPTA 4FCTA 3O7VX 2HT6A 3KJGA 4RWEA 3EIHA 2FZVA 5ABPA 1FJGK 4OV6B 4OHOA 5EUCA 3D31A 3NFAA 5FFMA 1JIXA 3K9QO 4Y6OA 2O0JA 5JJLA 2PJDA 4TTAA 1W85B 2C07A 2O4CA 1FYFA 1FFXB 1XZQA 2ZULA 3JD1A 3MJCA 3N28A 4JCOA 1YB2A 4JFRA 5D85A 3RQIA 5CEFA 3KT0A 5HCNA 5KYNA 2ZWPA 2F90A 4MUXA 1JDZA 2QLFA 4JKGA 1K5PA 1CR1A 1Z45A 2EW8A 2R2GA 2YV1A 3HJBA 3K0AB 3N0VA 3NX4A 3ZE0B 4KKOA 5CB4A 1Q83A 1II8B 1M0EA 2XGSA 3MWJA 4IFTA 3SEQA 5IAJA 5M1QA 3EXIA 3AR6A 3HZRA 4X62B 4HB3A 5LLTA 1CU1A 3G71N 2ADMA 3PXEA 4NFYA 3TOCA 5HUQA 1HL7A 1RYZA 3DT6A 4K7JA 1E7YA 3ORQA 2OLJA 4KFTA 1UEXC 3BEXA 4CG0A 3A5LC 3LWZA 3S9HA 3C94A 1RDFA 3REGA 1P1KA 5H3HA 4I08A 4FCYA 2AZTA 1V6SA 2FG7C 3MILA 4GUAA 4FNOA 3LWDA 5EKTA 2H31A 1EFPB 1Q0LA 4AIRA 4UE2A 4QS8A 1IRIA 1IXSB 1SRQA 2NTNA 2RKOA 2F48A 2WKPA 3VN5A 1NQAO 2X3YA 3CVOA 3O3MB 4ACAA 2GBZA 1CY4A 4YMGA 3ABSB 1EZ4A 3AUUA 3JVDA 4EGQA 3AEUB 1YFLA 1ZAYA 2BI4A 3TPZA 3RFFA 5EJ8A 1AZTA 3GO4A 2F00A 3SJAA 3IVGA 1JAIA 2ACWA 3D9QX 2YCHA 1RBQA 4QQFA 3W05A 1X8KA 3LH5A 4PAGA 5M3BA 2C99A 3K5WA 3V1NA 2UYCA 5C80A 3RYTC 2WIAA 3OPQA 3PFWO 3G2KA 5HDQA 1AGYA 2XVYA 4B76A 4FCCA 2NU7A 3ITHA 2O7SA 4PHTA 3Q7QA 2D1KA 4FPAA 3LDHA 1S1UA 2FMKA 3IUMA 4TLAA 4YAWA 4YCSA 3EPKA 3PX7A 5JEEA 4DDUA 1W73A 1EWQA 2KSQA 2VDRB 2YHSA 1SHUX 3ECSA 2OYRA 3UV7A 3ZHOA 1RQLA 5JMPA 3CF5L 2IGTA 4C7MA 4KQEA 5HUJA 2I2AA 3HYFA 1L0BA 1ABBA 1M83A 4QRIA 2R1ZA 5JR3A 1PFGA 4QPNA 1EEHA 3H7IA 4K9MA 4FJXA 4IV8A 4EMSA 1RADA 1ISGA 1JYSA 4JUBA 1SWVA 3HXOA 3C3YA 4PPQA 2IZZA 1FJGB 1G5RA 5CG1A 3I2FA 1EX6A 1R0BA 1EETA 1NZDA 3THVA 2FSVA 4FYXA 3GOIA 2J6HA 3VJRA 2P41A 1FFYA 3JWGA 1EP9A 2ZYUX 3BMQA 2VF8A 1V35A 4BG8A 4HNAB 5ADWA 2HB5A 1Z22A 1WZ2A 4ILGB 2ZWAA 4BVKA 1HFJA 2XUOA 1GWNA 1GLGA 1EFUA 3L2WA 3KOZA 1T0BA 2RJ3A 3O4JA 4G4JA 4OFWA 5AM0A 3LBFA 3G7SA 4Q7EA 4TLBA 2HREA 1WXHA 5LP1A 3JYNA 3EKSA 1X1CA 2WWTA 3FPKA 3FZHA 3A1WA 2ZUBA 3CRRA 3FTCA 1O5TA 3IVAA 3PNSA 3PUJA 4TS1A 2NT3A 1GXSB 1WY7A 1GAWA 1VMIA 1QHSA 1ZI6A 2RHJA 1AXEA 2VJMB 2BMVA 2GA8A 3DVLA 1LK7A 4KUEA 5ALYA 3WLQA 2NAFA 4AY5A 4CLEA 1RI1A 2G5PA 4P3OA 5FUBA 2W93A 1DC6A 1ZOIA 1JCFA 4FBLA 5J63A 2H5IA 1G41A 2H3HA 2C58A 5FJJA 3WR5A 1HZZA 5AM3A 2NADA 3IIKA 1OJLA 2O6HA 1BMFA 2ZE5A 4TTQA 1PWYE 5G02A 1HLFA 1QG4A 2D0PA 2O20A 3WYNA 4BBAA 4ZJYA 3KWJA 2HMAA 3EODA 4IIBA 4FYKA 5KSZA 4JI4B 4WFBL 3E2MA 4D4KA 4C4AA 3F9MA 1ODCA 3HPOA 4BLUA 3JATA 1Q0ZA 2Q0HA 1XZAA 4MDEA 3ILYA 1H8EA 3Q9NA 1V16A 4BGBA 2CMHA 3DB2A 5C7YA 2DB3A 4HN2A 5JQGB 2XKBA 4UMDA 1O58A 4II2A 3VPBA 3HLKA 1RKVA 4IFBA 2PS0A 3U0VA 1S7GA 3C6MA 3OE1A 3L7YA 4QGHA 4QVKA 1YZ3A 2MMGA 4BGIA 4CKZA 4BQOA 3U9TA 1U5BB 1QIJA 1R2QA 2YMQA 3FFWA 1S8OA 2E82A 4IRXA 1DWOA 2P5TB 4L22A 5DJ5A 3C3CA 5BNTA 2X5XA 5AVYA 1TW2A 1E5XA 1X6VA 2X74A 1TM3E 2PLNA 3HUDA 5FBWB 2BR5A 4I9QA 4TZ6A 4IIJA 3UHFA 4JP2A 2RKWA 3L5KA 4QBTA 1QVRA 2AV6A 3KQYA 1CLUA 3GEGA 3L8FA 2JKVA 2OG1A 4W63A 1EUQA 2UUBB 1QUFA 2UXBB 1VBFA 4V0LA 3COPA 1E94E 4JBNA 5AKZA 3VGLA 1U3WA 4NH5A 2V7QD 1FLVA 4WLVA 4DPLA 2O8BA 4HX2A 4DLXA 4YY3B 3BXFA 2OL4A 3DM5A 4ZKEA 2NUTA 3TQFA 2OXEA 2YNHA 3I52A 5T6BA 3DM9B 5F3DA 1W46A 1ZIOA 3LUPA 4MVJD 5KTKA 2ZUUA 4KB1A 1NY6A 5J4VA 4XFDA 4LFAB 3CGGA 2PO7A 1QLJA 2C5GA 1YKSA 2H1VA 2RHGB 2Y1DA 4EELA 3NH0A 2PV0A 3VR2D 4NJEA 4PHCA 4IPTA 3WK5A 1P8ZA 3M8SA 1N2CB 1OLUA 1ZOPA 2P7HA 4FQ5A 3TR6A 1LWNA 2FRDC 4UEOA 5EWMB 5GQSA 4N6GA 2DH5A 4RSHA 1SPXA 4DBZA 2J85A 5DH9A 1QCZA 1VPEA 2FI1A 4JUIA 1L9XA 1T9BA 4JB0A 2A4MA 2ZRKA 2BN4A 1MDUB 1BJTA 1I4TD 2NXWA 2VYVA 3GEMA 3ONNA 4PO9A 1LSUA 2RE2A 1TUBB 3S3OA 3JAMO 2JJMA 3H1GA 4GECA 5B64A 4R1QA 4V39A 3I0MA 1KTIA 2AQ8A 1WW2A 3STUA 2EDAA 1LLCA 3VR1A 3VJLA 4I50B 3PCRB 3P4UA 4FEEA 4RH3A 3L40A 4W9RA 4IJAA 3T9FA 4Z54A 3U60B 3TMAA 2IYRA 1C3XA 3QA9A 1AQIA 2B2XA 1QTQA 1JJ7A 4E3ZA 5AQRA 4XGQA 3OTOK 1L5MA 4RSRA 4FW9A 5CW2A 1EGVB 3RT1A 4N0QA 4AURA 3E7PA 1XNQK 5SICE 3DQZA 5JJBA 3CKMA 2KI5A 5C2FA 2WE7A 1YFJA 3PPYA 5KU1A 1NLZA 3T6KA 1AGRA 3GNQA 5JD4A 4F2GA 1ES9A 3UWKA 3VESA 1HG1A 2H2GA 3F5TA 5E2AA 4PSCA 1HPLA 2BI7A 4J0HA 1P45A 4RA9A 2VYND 4KB0A 1WQ4A 3QHQA 5BRDA 1DFIA 4NABA 4KQHA 2GM9A 4C4TA 3TQQA 5L7WA 3GLIA 1YTLA 2Q07A 1CUJA 2GM5A 3AVKA 4WESB 2YJ6A 3RADC 4KR7A 2I7XA 1NGAA 3NBUA 2C2XA 4CMKA 5EMMA 3WV4A 5AI4A 2B0CA 5IH3A 5BOSB 5AW7A 1EM8B 4O8CA 1ADCA 1RGIA 4HWIA 1BWPA 1L1QA 4B3MK 2QEQA 3PICA 4YAEA 1KVCA 3UKUA 2C3OA 3DEYX 4M7RA 5C31A 4DTNA 1SBHA 5EPEA 4IJ6A 4EYGA 5LQDA 1QMPA 8ADHA 3NHKA 4P4UA 1T9KA 2BKUA 4R9NA 5F2OA 3DAOA 3GLFE 5E84A 4NMWA 5BW5A 4CIBA 4BVEA 2B1JA 2RN2A 1CUUA 3BFPA 4KP7A 3WL5A 1R18A 1RTDA 1E62A 1GZHB 4BQRA 3K0FA 1NUHA 5C8YA 3QGMA 4KKVA 3TN7A 4M37A 3WB0A 5KYTA 1IPHA 1JPNA 5AKIA 4RVSA 1M8KA 2AOTB 5CPFA 1QSSA 3TYXA 1DU4A 1H1LA 2PKXA 1DX4A 4N5IX 2IOFK 1BE8A 3V1QA 4GWKA 4AN1A 2ZRAA 3E61A 5GY7A 1BVYF 2OZSA 4GC5A 1XD2B 4HC4A 4ND6A 5GZ3A 2P9LA 4LY7A 4LXUA 4PPYA 3WK8A 4DOMA 1V4BA 4HAYA 5IUNC 2QMOA 2IH2A 4JKHA 2GZSA 1PN3A 1JZTA 4E13A 3U6FA 1EIZA 3HYCA 1R6AA 4HDNB 2D06A 3AVAA 2MOKA 1NZFA 2O2HA 2P90A 4YJ3A 3AFIA 1Y82A 1JECA 1RYHA 4C4OA 2RGRA 1ACMA 1SIUA 1QM5A 4CZEA 3ELYA 4G4GA 4L3WA 1CUFA 2ZRMA 4ZWNA 1DKGD 4EHJA 3CLSC 5JSFA 3NXKA 2G8WA 2IBTA 3EGXA 4N48A 1NI3A 4G63A 3JQ9C 2PJZA 1MRZA 3G1TA 1SAYA 4K87A 5G0SA 3ZDZB 1CETA 4WA7A 3H2SA 2BOVA 3DOIA 2RHCA 1F60A 2VCHA 3A9UA 2W4QA 3FMFA 3OCZA 3ZR4B 3GLGB 2B5VA 4Q3NA 1WPGA 1C0EA 1KP2A 3QPUA 3EVGA 2J4FA 1RXYA 5DKFA 3LTEA 3A2MA 2GPAA 1J8DA 1G2QA 3H8JA 3WWYA 5LDDC 2DPYA 1DHTA 1UKYA 3VDXA 4ZI7B 1NFQA 1M1YB 2P9EA 5KDLA 4DUZB 1H0RA 2NPIA 3KXKA 4YRIA 2VPZA 3HU2A 1UBSB 3M82A 2GDZA 2D0PB 3I5MA 1K97A 3AL3A 5ENVA 2VT6A 1T5IA 3USZA 3N07A 3ZU3A 2AUTA 4OGEA 3DPUA 5H59A 3K9CA 3EZXA 4UBIA 1H5UA 3EDYA 1T1GA 2EYQA 1Y8AA 2JF0A 2UUPA 1Q50A 3FTNA 3O8NA 4Q15A 2X2OA 1EUCB 5TF0A 4Q37A 1Y3CE 2OV8A 5IRCD 1ORHA 1ZVQA 5AQQA 2QRZA 2EBFX 3OIDA 2VL7A 1NGIA 3TOVA 1XBTA 4HAIA 2J6BA 1U0SY 2I6UA 4FXOA 3RAJA 5C1DA 3AV9A 4I50F 4KH1A 6AT1A 4BNWA 3R8EA 1WKVA 1Z2PX 1JFTA 2BFMA 2C57A 3LPTA 4DV5K 2D54A 3QXSA 4UM5A 2D2IA 5JBQA 4AI6A 3UKUB 4G8JA 3UCEA 2ZIUB 4C0KA 1Y8RA 4GZLA 3L0ZA 1QDUA 2JI6A 1CVRA 1C41A 3DFUA 2OAQ1 5LQKA 3OVMA 1UDBA 1JXOA 2WWGA 4XB1A 2OHHA 3KXLA 2IXDA 1D6NA 1WAJA 1R27A 4AF7A 4KXYA 4H5VA 3STTA 4EJ6A 1OBVA 5C53B 4ZVQA 2EXXA 5G4LA 2O4IA 4ETIA 2NUTB 3N87A 3Q3JB 3KEOA 4H6XA 5AVKA 2IX9A 5KYUB 1GKIA 1KBOA 1KP9A 2DSNA 2X7HA 2XITA 1N25A 1J70A 4BRSA 4HNGA 4DFJA 3ZX3A 3ZYZA 4WINA 4NOLA 5C35A 1W0CA 1X13A 4ZI7A 1N2EA 2QZJA 5BYJA 2KHZA 3CSUA 1OBFO 3GWGA 3PD7A 4WQ4A 4LEIA 4CQMB 2BFAA 1N36K 4MPRA 5HZGA 2ALJA 3QIAA 4XOIA 2W41A 1EVJA 3TSQA 2GBLA 1AKQA 1JFLA 3ZDDA 1TVRA 4WK0B 4D98A 5IEJA 1CIVA 3TGPA 3BH0A 4BKUA 1LVUA 1XDZA 2EFHB 5AJTA 2V4MA 3EGXB 2OYSA 3OCXA 5L3ZA 3IAFA 1QH8B 4TRNA 4YDSA 1ND5A 3AG5A 1KY5A 4L78A 2ZJYA 3LPAA 1S2MA 1DTSA 1WE2A 2Q3HA 2CYBA 1FB5A 4PV7A 5DK4A 2VJNA 3HCOA 4CMBA 4XGIA 3W3ZB 4L0DA 1JLQA 1KMQA 1A9TA 4YFUA 1R8QA 2QTBA 3ZSWA 1HRKA 4GPIB 4UDYX 3JYTA 1RQXA 1U1IA 5BQPA 4CR6A 1GQFA 5BSVA 4F3YA 1ATZA 1SCKA 4NYMQ 2R0QC 1DL5A 3PQ2A 5I9MA 2IUSA 2ZSEA 3MJHA 3MN9A 2ZXFA 2PUAA 5C42A 4QXAA 3ZWDA 4AP6A 4JK7A 2OHGA 1C30A 2C3YA 2QRKA 1MOPA 3ED5A 1U65A 1MO5A 2HL6A 1AK9A 2I7TA 3PY8A 2KM1A 2A7XA 5ALUA 2E2OA 3ENVA 5HJ5A 3I62A 3A1SA 1NGFA 4QO8A 4ITUA 1R6VA 2BFFA 2IUYA 1BDBA 2QTMA 3ZEUA 1ONPA 5EOVA 1D07A 3P27A 5J4HA 1OX4B 3SYZA 1STOA 1ZM4A 2X5JO 3I9FA 3H9UA 4DU3A 5KHLB 5CNMA 3WXBA 2GUIA 2SCUB 1E3WB 3KPUA 3LC7O 1VJRA 8ATCA 2I4LA 2WBLC 2WE8A 4R98A 3IC5A 3AVLA 1PT8A 1EWYA 2DFEA 4G09A 1AS0A 2XQFA 1OC4A 2GLUA 2B1IA 2BMWA 2OV3A 3MS2A 3H1AA 3GT3A 1KYYA 1L8AA 1Z73A 2Q1XA 3HS3A 4B6QA 4EUNA 4LZNA 3COWA 4LOHA 1WHSA 1CRWG 4OXRA 4PZDA 4R3UC 2IEIA 4NEQA 4AG6A 5CLQA 1RP7A 5K09A 2DVMA 2R00C 4DL9A 3VR6A 2R4TA 1RBRA 1GPH1 3TTXA 3V34A 2ZSJA 3Q72A 1D5AA 2YI1A 1NNEA 3OP4A 2QMHA 1N1EA 1ESZA 1HV8A 3PE4A 1SM4A 5J2UB 5HRAA 4WLUA 3ROZA 2HX1A 2VLBA 1XDSA 3CW2A 2UZ4A 2YV0X 1G1MA 2CGEA 2RC5A 4WA8A 3UT5B 1VE3A 3R20A 2KMLA 4KMMA 4EHUA 3B6MA 1YZGA 1K5GA 2BFDB 3IVRA 4IJVA 3GIWA 5FBHA 5FA5A 1HDGO 3BFKA 4AZSA 3D3QA 4CBXA 4V0OA 1B8UA 2XTAA 1LRKA 2V4UA 4OYRA 5E7JA 3HSTB 3P83D 1JQLB 3GRFA 1X15A 1GCUA 4KO2S 3FGUA