5T7BA

Argonaute-2 - 5'-(e)-vinylphosphonate 2'-o-methyl-uridine modified mrttr guide rna complex
Total Genus 227
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively.

Total Genus
227
sequence length
837
structure length
802
Chain Sequence
b'FKPPPRPDFGTSGRTIKLQANFFEMDIPKIDIYHYELDIKPEKCPRRVNREIVEHMVQHFKTQIFGDRKPVFDGRKNLYTAMPLPIGRDKVELEVTLPIFKVSIKWVSCVSLQALHDALSGRLPSVPFETIQALDVVMRHLPSMRYTPVGRSFFTASSNPLGGGREVWFGFHQSVRPSLWKMMLNIDVSATAFYKAQPVIEFVCEVLDFKSIEKPLTDSQRVKFTKEIKGLKVEITHCKRKYRVCNVTRRPASHQTFPLQQESGQTVECTVAQYFKDRHKLVLRYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIRATARSAPDRQEEISKLMRSASFNTDPYVREFGIMVKDEMTDVTGRVLQPPSILYGGRNKAIATPVQGVWDMRNKQFHTGIEIKVWAIACFAPQRQCTEVHLKSFTEQLRKISRDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYAGLQLVVVILPGKTPVYAEVKRVGDTVLGMATQCVQMKNVQRTTPQTLSNLCLKINVKLGGVNNILLPQGRPPVFQQPVIFLGANVTHPPKKPSIAAVVGSMDAHPNRYCATVRVQQHRQEIIQDLAAMVRELLIQFYKSTRFKPTRIIFYRNGVSEGQFQQVLHHELLAIREACIKLEKDYQPGITFIVVQKRHHTRLFCTDKNERVGKSGNIPAGTTVDTKITHPTEFDFYLCSHAGIQGTSRPSHYHVLWDDNRFSSDELQILTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKRDHQALAKAVQVHQDTLRTMYFA'
Loading diagram...

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

molecule keywords RNA (UVP)UAUAGAGCAAGAACACUGUU
publication title Protein structure
rcsb
source organism Homo sapiens
molecule tags Hydrolase/rna
total genus 227
structure length 802
sequence length 837
ec nomenclature ec 3.1.26.n2: Argonaute-2.
pdb deposition date 2016-09-02

pfam database annotations

chain Pfam Accession Code Pfam Family Identifier Pfam Description
A PF02170 PAZ PAZ domain
A PF02171 Piwi Piwi domain
A PF08699 ArgoL1 Argonaute linker 1 domain
A PF16486 ArgoN N-terminal domain of argonaute
A PF16487 ArgoMid Mid domain of argonaute
A PF16488 ArgoL2 Argonaute linker 2 domain
Image from the rcsb pdb (www.rcsb.org)
cath code
ClassArchitectureTopologyHomologyDomain
2.170.260.10 Mainly Beta Beta Complex paz domain paz domain 5t7bA02
3.30.420.10 Alpha Beta 2-Layer Sandwich Nucleotidyltransferase; domain 5 Ribonuclease H-like superfamily/Ribonuclease H 5t7bA04
3.40.50.2300 Alpha Beta 3-Layer(aba) Sandwich Rossmann fold Rossmann fold 5t7bA03
1FKOA 4IG0A 5TQ0A 3C3KA 4FM0A 4RU1A 3UK0A 3EDCA 1ZAYA 2FN8A 4WXEA 1D5AA 3QO9A 3SCXA 3U3GA 1NXTA 4NGDA 4N41A 2WJAA 5CZ1A 3NF8A 1ZITA 3V1OA 2FBTA 1E6LA 4KAZA 2JBAA 4KVFA 5I4CA 2VYCA 5IEBA 3C95A 4M88A 4RKQA 4R5PA 4NYNA 5CNJA 4NGGA 3K9CA 1IIBA 2VG5A 3QX9A 3QEKA 1PUXA 3QLHA 1ASWA 3ALYA 1L3TA 2PUFA 5HLFA 4RS3A 1MAVA 4EP5A 3H5LA 4OKJA 3CNBA 1DCMA 5K14A 3AVAA 3PX6A 4HCCA 2O4IA 2PUDA 1M2FA 3ZT0A 4RK5A 1FFWA 4BWJA 4DSKA 4CFAA 4ZMSA 2G8UA 4XXHA 4MS1B 3QETA 4QICA 1X9SA 9ABPA 5IX8A 4G0QA 3VQ9A 1HNIA 5I3UA 4F8RA 1KFDA 4JB2A 2QXYA 4DTXA 1GUBA 1YVUA 4IGAA 4G0XA 3T95A 3L8BA 1KLMA 1VPWA 2LBPA 4KHQA 5IC5A 2IPNA 3A3KA 1NOYA 2FC0A 3LUKA 4KFBA 4CE9A 4NH6A 2GV9A 1IKVA 3K59A 4Q6BA 3VN5A 4KHSA 4BE2A 4CF9A 4CF2A 1JFVA 2VUHB 4HVJA 4MS1A 1VLZA 3N75A 1CLQA 1J53A 2M98A 1NXVA 3DGEC 5B3JA 2ITGA 3KK3A 4LE2A 2G8VA 3MECA 3VQ6A 1EWKA 1AB6A 3LZIA 1DBPA 4O55A 1ZBLA 1NTRA 1IH7A 3AVJA 2W42A 2PUBA 1I3CA 3F7NA 5C5CA 3CM5A 1XWWA 1UAXA 4KMRA 4PWDA 5J2MA 1RZRD 4DQQA 4F11A 1XHEA 1HQUA 4G0OA 1GUDA 1VSFA 4YRZA 3LKBA 2B5JA 1NKCA 2X78A 1Y1LA 3OYMA 4IFVA 3KIOA 3OM1A 4EZ6A 3K57A 1JDNA 4EUKA 1QNLA 5EWMA 1UA1A 2OPPA 1TVMA 4ID1A 5FWXB 2WWVD 3RVMA 3CFRA 1ZN2A 1SL0A 4OKEA 4DU3A 1YK1A 3NHZA 4NQRA 1TM2A 4CGDA 4CJ3A 3OY9A 1E6KA 3PUFA 4HHTA 1VK0A 1LBHA 3C3WA 4GPAA 3L3UA 3O2JA 4NGBA 4HUGA 4JB0A 3VQEA 4I7FA 5ABPA 2LP4Y 3SV3A 4FJ7A 3NE6A 3KKEA 2FBXA 4B3OA 3CTPA 4F8JA 1C0UA 4LH5A 1XI1A 1QO0D 4G0PA 3O3HA 1LWFA 4O4GA 3RRGA 3CM6A 4ZHRA 1PEYA 5IBQA 1ISRA 1F21A 4FJIA 5FWXA 3BBLA 3KK1A 5CYQA 2QV0A 1CXQA 3DGFC 2P51A 4ML3A 4N47A 2KW4A 3HDGA 3QX8A 1PNTA 5CHYA 1EETA 2MYUA 2B6AA 4CGGA 3C6UA 2WB4A 4S05A 2P5OA 4E7OA 1Z16A 4YNQA 3TI0A 3LP2A 4DQPA 1U45A 3CRNA 2HW3A 3LWMA 3I8DA 1JLCA 3A10A 5KC8A 1JL2A 3K5LA 3M8PA 5HROA 1NKBA 3OO0A 3FFTA 1ASVA 3CS3A 4FM1A 1NOZA 2DTUA 3SM9A 1JLBA 3DZDA 3QIOA 1R0AA 1M5TA 4IMIB 1QSLA 2HHWA 2D0BA 3QLUA 3HP6A 4ZPJA 4E7HA 1MB3A 3RR8A 4CHPA 4I9QA 3IP5A 4HUEA 2KZMA 2AYZA 4ELUA 4JA2A 4HTUA 4FJ5A 5DK5A 4AHSA 4UQGA 5J2NA 4DF8A 3AVIA 3JS5A 2F8TA 4F3TA 3NBPA 3TMYA 4J2EA 1SD5A 4MS3B 2E6LA 1XHXA 4OATA 3TAMA 2E4VA 4RY9A 1NK6A 5D3GA 4CHYA 3FFXA 4S04A 4LSNA 2GBZA 3ZSXA 4OLBA 3VQ4A 3HV2A 3NGYA 4E89A 4NICA 3C3MA 4HNSA 3L2WA 4WWHA 3AA5X 4EYKA 2R7YA 3TO5A 1R4KA 4RK4A 4RDCA 4P98A 4RY8A 4L4UA 3ITHA 1C6VA 5JNUA 3QLTA 2KTQA 1U4BA 3CQ8A 4DQDA 1S1XA 5SZTA 1QE1A 4Z4EA 4FLZA 3NDKA 3TARA 3JPWA 4M3YA 1I3AA 1QSSA 1VSEA 4KI4A 1S1UA 3AVKA 3LUHA 1EP4A 4DWIA 4LE0A 5HSGA 5E41A 4MS3A 1DRKA 2L19A 3LP0A 1RXIA 1KRPA 4DFPA 5CNKA 4I9LA 1LK0A 4TN5A 4CIEA 3RVSA 4FW1A 3MA0A 3K5OA 2XDYA 4EYQA 4M41A 3MMNA 1D1QA 3NAEA 1B9FA 2CD7A 4DF4A 3HUUA 1WSHA 3I0SA 2PKXA 4B9SA 4EYOA 1BIZA 3H5WA 1NJZA 3RVPA 3BRSA 3TD9A 3OYCA 1DZ3A 2G8FA 1RNHA 3HZHA 5HKOA 3SG0A 3I45A 2HHUA 4CF0A 2LSNA 4AHRA 2IPLA 3U6FA 5JNVA 5HRNA 3LZJA 4CGHA 1NKEA 4GMJB 3R0JA 3MXIA 5T7BA 3NHGA 3HCWA 4IMJB 4CJRA 3ROTA 3CLKA 4Z99A 3Q9SA 1TKXA 4IILA 4DS4A 2B4AA 3BRQA 3AVLA 2PZSA 1Z15A 2OZSA 1SKWA 2EX3A 3KKRA 3K5MA 3HO1A 4D74A 1C0MA 1CZ9A 4DMNA 4Q5VA 4FK4A 3MXJA 5BRAA 2ETJA 1VYNA 4FJJA 3E01A 3CU5A 2XFMA 1K6YA 3IP9A 4XASA 3QEWA 1VSIA 4Y9TA 1A5WA 3CHYA 3CKMA 3LP1A 3NBMA 1BISA 3ZT3A 4FE7A 3JY6A 1TV6A 4DU1A 2GWRA 3ILYA 4M3WA 3QIPA 3HS3A 4PE5B 1JFTA 4FM2A 3FFIA 3RVQA 1U8TA 1QS4A 5CYMA 3HPGA 3DRRA 4KPYA 1IKYA 3O74A 3JSMA 4HYEA 3DMJA 1ITGA 2PL9A 3T1AA 3B2NA 4FB4A 2ZWMA 3T38A 1RT4A 1U47A 4O5AA 3M6MD 4MQEB 4DADA 3AVGA 3H5TA 2HHQA 5JS1A 3F73A 3NGZA 3OS2A 4YCSA 5DMRA 4FLVA 2MYNA 4FJHA 4PY5A 3IPAA 3LUAA 4W5NA 3JYTA 3QESA 4DSFA 1TKZA 1EWVA 4DFMA 1U49A 4KK4A 3OLWA 4EP4A 1E6MA 3VQQA 1QSYA 4FLYA 2VG7A 4Z4CA 2FSPA 3O7XA 3LPTA 3QIRA 2PY5A 2PUEA 3OYKA 2YNFA 1BIUA 4DG1A 3THVA 3LPUA 4G1QA 4NHAA 4DU4A 4KTZA 3IAYA 4QPJC 3OS1A 4LSLA 2O20A 2P4UA 1T7PA 1CYEA 2FQXA 1EAYA 4YR7A 3AO1A 4MQEA 3DLEA 3UIQA 4B9NA 3ZSQA 1X9WA 2YNIA 1QQAA 3FFWA 1L5YA 4KK3A 4IDKA 1BAPA 2HPHA 4E0DA 1KVAA 4CEEA 3LFTA 3FGZA 2NZVG 2RKIA 5CNMA 1Z2DA 2RF2A 4YWHA 4W5RA 2IAJA 5JNSA 3TX6A 2PE5A 1SXIA 1RTHA 1LV5A 4E1MA 1L5ZA 4LDAA 1QTMA 2FFLA 4IG3A 4IF4A 4ZYLA 4OG2A 4DSJA 3AO4A 4NGCA 2BGGA 2P5GA 4E7PA 3B6OA 1ZBIA 3H6HA 4CK2A 1ZDMA 3SV4A 2B1JA 3S3OA 2QSJA 2YKNA 3NNDA 1WSEA 2ID7A 3OYJA 1SKSA 1NK4A 2J48A 1B9DA 2RGYA 5GQSA 1RBUA 4F2SA 3VQ7A 4DQIA 1RT2A 4O5BA 3VQBA 4N76A 2RJNA 4IRXA 2YV0X 4TMYA 3HDVA 3AA2A 4JS4A 3ASMA 1DCFA 1BHLA 3V9ZA 2RPIA 2E4YA 4GNRA 2OENG 1KLNA 3HSYA 3T19A 1SI3A 3L2QA 1CHNA 1KTQA 3HVRA 4PUOA 4KQCA 5DTEA 4CGFA 5EWLB 5BQ3A 1UDRA 4LD0A 3OYFA 3OLYA 1YMVA 3N6VA 5FBKA 3CYMA 3RVNA 3RMCA 1USIA 4ETNA 2HQBA 4OJRA 2KZZA 3CFOA 4KNYA 4L8RB 1FQWA 1C4WA 2ZD1A 3Q7RA 3VQAA 1NXSA 4C8LA 3KSMA 3GBPA 3O1JC 3NFAA 4WXMA 4MRMB 3QELB 1VRVA 2OZMA 1FSPA 1SI2A 1ZVVA 4B8CA 3H08A 3F9KA 4CHNA 4B9MA 1XWLA 4CJ4A 1ABFA 1BA2A 2JCGA 2FTKE 4O0JA 4QOZB 2FLWA 3V9XA 1ZBHA 3H1EA 3DLBA 5DLEA 3SY8A 2WONA 3VNAA 4XAQA 2CHEA 1DLOA 3V9SA 5EWLA 1USGA 5HRRA 4NCBA 3KK2A 1HYZA 6CHYA 3AO2A 4EVSA 3OJSA 2ZAYA 4RK1A 1XC9A 3LWLA 4MQ3A 3SUOA 1U2QA 4CGIA 3BILA 4JRQA 3NCIA 5TPWB 3K4HA 2B4JA 3QEVA 3IP6A 1HNVA 1XHZA 1J9AA 1SXGA 2V0NA 5EU7A 4MRMA 2QVGA 3QELA 4CJLA 3N53A 4N0PA 4RW4A 1BI4B 4G86A 3A2FA 2FVYA 2QXFA 1JLKA 1Y97A 2ZE2A 1TL3A 4DTUA 1GOBA 4RW7A 3MEGA 2QK9A 1QQBA 3HXMA 4EVQA 4BE0A 3KLOA 1LAVA 2L17A 4B9TA 2FEPA 2IDOA 2IPAB 2OPRA 2BDPA 1YTUA 1C1CA 2GKGA 4LDZA 4Z4IA 1N5YA 2KFNA 3LDSA 1SV5A 5JNTA 4RXUA 1RBRA 2PUGA 4MGEA 3LAMA 3DYAA 1WETA 4UHJA 5TPWA 3AVHA 2PL1A 1OXKB 2Z1IA 1YTAA 3LAKA 3O1HB 4PEVA 4CEDA 5JS2A 3S99A 5FRNA 3EY1A 1TJYA 3LP3A 1HYVA 1QPZA 4DTNA 2HNZA 3EULA 1RDBA 3L6UA 1VSDA 2PYJA 1NK7A 3M9XA 5B3JC 1JDPA 4FK2A 1S8NA 4W5QA 3URMA 4BDYA 4DTJA 2VWKA 1DBQA 1NY5A 1TK8A 2JLEA 3AVCA 5IEJA 1BGXT 4FZYA 2BANA 4AHTA 2HVHA 4FYDA 3NH0A 2PAFA 3F6PA 2IDMA 2FBYA 3I09A 3SQ2A 2HQOA 3D0PA 1VSKA 4FW2A 2OQRA 1JFSA 2HMIA 2JRLA 2FMIA 3TANA 3HM9A 4N0QA 1ISSA 1JBEA 2OA8A 2NT4A 3CFPA 1DTTA 3SPYA 4DSIA 2X7XA 3H75A 5KGWA 1YS7A 2FW0A 3L49A 3OO1A 4I2PA 3RVOA 2FMFA 3FDFA 1ZH4A 2OPSA 4H4OA 3L3VA 1XHFA 4HUFA 1D9DA 1U48A 2FEKA 2A9OA 1TMYA 4CEFA 1NJYA 2XO7A 3DLKA 3GL9A 2CHFA 4QAGA 3B6PA 4Z0UA 2A1SA 5CNIA 3ZSRA 4CJKA 3CZ5A 3RRHA 4OPJA 4DLGA 3UKJA 1JXBA 3I5AA 5HBMA 1D8YA 4M3XA 7ABPA 3AA4A 4TLMB 3SUQA 3JVIA 3KKSA 2D5RA 5C5EA 4MR9B 3GA5A 1C0EA 4WT7A 1IKXA 2A9QA 2P1JA 1ZBUA 3OMXA 3MYYA 1K66A 3TR8A 3RVRA 4ZMRA 1EWTA 3EJWA 1P6QA 1X9MA 2WJWA 2X6SA 4KV8A 4N56A 1A5VA 4TLLB 5C24A 4BE1A 1BQMA 2IPMA 5J2QA 1HQEA 4G0MA 4FLWA 3KD5E 3JPYA 4BDPA 3RWUA 4CF8A 1C0TA 4KTQA 3AVNA 2PUCA 3VNBA 1AB5A 1RILA 1NXPA 3DOKA 4NCAA 4E3SA 4YLEA 1L5UA 4B9LA 1ZHHA 1APBA 3KTQA 4CFDA 1J5OA 3HPHA 3QERA 1MU2A 1IO2A 4JRPA 3N0WA 1U04A 2QR3A 4CJFA 1T8EA 3RVKA 3CG0A 1VRTA 1D4ZA 1U0SY 4DTMA 2NUBA 4Z9AA 2EHGA 4CJPA 1QQCA 3EQZA 4MR9A 2D0AA 4O1HA 3H1GA 3OYNA 1CZBA 1DTQA 3LALA 2L18A 3O21A 3KG2A 3QLUC 1GCAA 4M3UA 2R25B 4NGFA 3K58A 2E4WA 3O4NA 3PX4A 5PNTA 1W0HA 4YO7A 3MEDA 2Y1IA 5BRJA 1UA0A 2OPQA 3RMBA 5CZ2A 3P83D 4FZZA 1Z17A 2HSGA 3C6TA 1JLEA 1P6UA 1RNLA 4HNRA 1RTIA 2FEWB 3ISNC 4G0ZA 4CIGA 3C97A 1GCGA 4Z4FA 2WRZA 4CJVA 4MQFB 1IKWA 4LE1A 4O1IA 5TQJA 3NNNA 1A2OA 3V1RA 2QVWA 1RT6A 1TAQA 1ABEA 4DQSA 5IULC 3AVBA 3KJVA 5TQ2B 3VQDA 3LUJA 4YFUA 5I42A 1TK5A 3AVMA 3RMDA 2Z1GA 4OKKA 1QHTA 4E7KA 4H8KA 1URPA 5HP1A 2YNGA 1RCHA 2R4QA 2JK1A 4NCGA 4PICA 3P9YA 2FBVA 1G15A 3LUFA 4RK7A 3VQCA 3ZSZA 2G8IA 2JVKA 1J56A 4KHWA 4QCLA 3QEMB 3OYHA 5D2CA 1LW0A 1KMIY 2IGIA 3T6KA 4J2DA 2N9UA 3QEPA 2KYRA 2E4ZA 3KHTA 4D6YA 4KRFA 4MQFA 3L2VA 1WSIA 3EQ2A 3OS0A 4AHVA 1HEYA 3H5IA 5TQ2A 1LJUA 4P1ZA 2ID9A 5BR1A 3HSTB 4PYRA 4Q7EA 3KYIB 4ZTJA 1KRXA 3OYGA 4G0YA 3G0ZA 2PLNA 4EY3A 3S3NA 1B00A 1DC8A 1KRWA 2NT3A 1BCMA 4LRQA 3SI6A 2FQWA 4L85A 8ABPA 1EXQA 4CEQA 3HK2A 1NXXA 1JXEA 2YHAA 4FLXA 4XARA 3V6DA 3S9HA 2FMKA 3QEMA 3TABA 1ZGZA 4MS4B 2YNHA 4CJWA 4EVRA 1RBTA 1UOCA 4EYGA 1FFSA 3V9UA 3SUPA 1NJWA 3Q41A 3HJFA 1Z12A 2GBPA 4QYWA 1JYEA 3OYEA 5JNWA 4K8XA 4BACA 4AHCA 4KREA 4RK0A 3RQIA 3LUGA 1GLGA 3DRSA 4CJTA 3MXMA 3EZ5A 4CJEA 1L3VA 3GYBA 4NH5A 1M2EA 1WSGA 3CFYA 4KHNA 4XLTA 1RBVA 3O1IC 3G10A 3DI6A 1S1TA 4FJNA 4CEAA 3RVLA 4RW8A 3SPZA 1KSPA 5FROA 4W5TA 1CEYA 1Q9XA 3M9WA 1A04A 2L5DA 4H4MA 2RDMA 3LANA 3ZT1A 4CHOA 3ZT4A 2D0CA 5SWMA 3OYDA 2HQRA 4FJ8A 2WMYA 3V9WA 5KI6A 3ROFA 3VQPA 1P8AA 3GWGA 4RXMA 1WSFA 3QK7A 4CJSA 4ID5A 2FKAA 1QP7A 4OTZA 5KGXA 3KS9A 1Z25A 2IOYA 4HNQA 2HHSA 3IG1A 4KTWA 1L3UA 1RXEA 5KQPA 2JBAB 1VSLA 4DN6A 1WAFA 1A0OA 3GV0A 3M8QA 4OLAA 5KWSA 1S9GA 3KLNA 1A5XA 5J1EA 4B9UA 2JGUA 3O7VX 3K5NA 3N0RA 4CJ5A 1YS6A 4XFKA 4YV7A 3ZSOA 1R8JA 2NZUG 4FXDA 3TAFA 3HVTA 2JVJA 1T2RA 1TLFA 3O2SB 3EAFA 1JH9A 2A9RA 2FMHA 1TGOA 3AVFA 1HRHA 3A0UA 2R48A 2A1RA 1F4VA 3VA0A 4H3HB 1R6ZA 3IP7A 4DTOA 5HRPA 3SAJA 1FK9A 5KRSA 3OYBA 1YT3A 4XIUA 1FXXA 1WSJA 1YMUA 1JLFA 4FE4A 4Q6WA 1GOCA 1H9CA 4CGJA 4OVLA 4DTRA 4RW6A 1LAWA 1BDJA 4CESA 1RZRA 1S1WA 3I42A 4M3TA 3RMAA 3O2QB 4B09A 3EODA 4H3KB 3FMVA 2KQ2A 3RH0A 1KVBA 4O44A 5EWJB 3M8RA 1SL2A 2WY2D 1VSJA 1X1PA 4KB1A 3NF6A 3BDPA 1NK0A 1T34A 2HHXA 6ABPA 4O0IA 3O6EX 2AYXA 1EKEA 3SQ1A 4J2BA 1MVOA 2GX6A 1EFAA 3E61A 3LMKA 4KV7A 1TKTA 4RG8A 4Z9BA 4ZTFA 3H1FA 4Z4HA 3HL8A 3KYJB 4OBBA 4OGEA 1NK9A 2E4UA 4RV5A 1RDAA 4EZ9A 3O4QA 4AH9A 3AV9A 3QLVA 4PQUA 3LTEA 4JOQA 4JAVC 2L2QA 2R47A 3HUTA 5IUJC 4WZZA 5KC9A 5F64A 1QMPA 3M8SA 5C42A 1NXWA 1PEAA 4C8OA 2H3HA 4CHQA 5HRSA 1O1WA 4FCYA 3SQ0A 5EWMB 5TPZA 1ZGGA 3T3FA 4D6XA 3OVNA 2PMCA 5EWJA 2Z1HA 1QO0A 2G8WA 2P9HA 2HHTA 3D8UA 4KZKA 3H5VA 4Z0NA 3DRPA 4IBNA 2QW1A 2I5JA 1TK0A 5CY4A 3NH2A 2MYTA 3E3MA 5KRTA 4B8AB 4CFBA 4KI6A 1J54A 1FFGA 2TMYA 4M45A 4E7JA 2X6NA 1QP4A 4GVMA 2PJUA 4NYFA 1NATA 1RDDA 3SQ4A 1M5UA 1HPZA 3H6GA 3VQ5A 4KQ9A 5GOTA 3QEXA 4KO0A 3N0XA 1KCFA 3Q7TA 4ETIA 3V1QA 3NNSA 4KHUA 2L5CA 4CFCA 4B08A 4CEZA 1JYFA 1W9HA 2PYLA 3GT7A 1N6QA 4DTSA 3OQMA 4E19A 3HEBA 1RDCA 3W9SA 1BI4A 3OJUA 1RTDA 1HYSA 3CG4A 4YP9A 3QLVC 1ASUA 1YIOA 1USKA 2RN2A 1SKRA 1L3SA 2IOCA 1NXOA 3DOLA 5DGCA 3ZT2A 4DTPA 3MEEA 2G8KA 1DBWA 3T8YA 1WN7A 1DJMA 3HPOA 4FJKA 3F6CA 3ULDA 2HVIA 5DKFA 3ILHA 4RK6A 5KQLA 4FJMA 4WUTA 1QKKA 4Z4GA 2KFZA 5TPZD 3LOPA 3PV8A 3OYIA 1S1VA 4FLUA 1RT3A 4CK1A 4AHUA 3L2UA 2I6FA 1IG9A 2G8HA 3NHMA 1ZY2A 3OLZA 1LJLA 3DM2A 4JLHA 2E4XA 2Q3SA 2QKKA 1T2SA 1RT7A 3WNEA 3O3FA 1LWEA 4FVMA 4CECA 4CHZA 1VKRA 2FQYA 3IS9A 3PO5A 3KD1E 3PX0A 1P2FA 4FJ9A 2RJOA 3OQOA 3RTVA 3KTOA 1D1PA 2E6MA 1REVA 3EGCA 4MAAA 1HJRA 2M1ZA 1S5JA 1Q9YA 2XY5A 5IUKC 1BCOA 4EGSA 2X74A 3OLXA 2XY8A 5FWYB 3QNNA 1BDIA 3KLEA 3PO4A 2ZQBA 1JX6A 4J2AA 1FKPA 5DCLA 1BQNA 3L2RA 4FLTA 1RPJA 1DG9A 5TE9A 1TVRA 2VK2A 4N03A 1YK0A 4LY7A 1LW2A 2DFHA 3SNKA 2WOMA 1KFSA 5HM6A 4RW9A 2IC3A 1Z18A 5KQGA 1DCKA 3U3YA 2DRIA 5FBHA 4QYMA 2A9PA 2Q5CA 2HB5A 4OGCA 4NV3A 3IDOA 1SUQA 1BDHA 2XY7A 2AJQA 3V4IA 2MSKA 1RBSA 1K68A 2VG6A 5FDLA 1DC7A 4ELTA 3BGRA 4N5SA 3IPCA 3SNNA 1PHRA 3HYFA 5T3YA 3LUDA 3MJ0A 4TSXA 4DSLA 2YKMA 4JASB 1DRJA 4RXTA 1C1AA 5FWYA 3O3IX 3ZSYA 1RT1A 4ELVA 3HT3A 4DS5A 1ZBFA 3TAEA 4C8NA 3PY8A 3QINA 4F12A 2MSLA 1NJXA 1LWCA 3CZCA 4CF1A 2HNYA 4B9VA 2JB9A 3MAQA 4WE1A 1ZESA 3N8IA 3O75A 3TAPA 1GOAA 2FXIA 3TB6A 4UHKA 2GUIA 4F3OA 1VRUA 3IRXA 3TAQA 3KLIA 2ATQA 1EHCA 4CJUA 3TWHA 1WAJA 2DFFA 2O4GA 3WNGA 5C25A 2E4LA 4HCBA 4F2RA 1T03A 2DY4A 3BREA 5ED4A 1D9FA 1C1BA 3OLVA 3ZSWA 3GBVA 1WNSA 4FJXA 1ZH2A 4IKFA 4DLEA 4E1NA 1SL1A 4F06A 4GW6A 2JVIA 1JL3A 1HMVA 2GI4A 3TAGA 1KGSA 1JLQA 2QZJA 2IKSA 3P5JA 4W5OA 3JTEA 2LIVA 1BVHA 1S6PA 5IUNC 1MIHA 3D45A 1KVCA 1JF8A 3AO5A 2PUAA 4OPKA 2LPMA 2MSWA 4CJQA 4C8KA 3V81A 4CBVA 2HHVA 4CIFA 4RKRA 3KLHA 3S3MA 4KKOA 3RR7A 2LUOA 1JLAA 1B92A 3C6QA 4DFJA 1RT5A 1ZYQA 1Z13A 4LX8A 1LBIA 2HNDA 4JP1A 1NK8A 2QVCA 3KJXA 1Q8IA 1BL3A 3D02A 2BE2A 3I0RA 2YHBA 3MQ4A 4KHYA 3H5OA 1U2PA 3UUGA 3A0RB 5J2PA 1WLJA 3VQ8A 3ZSVA 2IS3A 1JL1A 4G97A 1JLGA 4F4KA 2IYNA 4MLCA 3P1GA 2FN9A 4RZSA 3C94A 3NGIA 2XY6A 1VSHA 2QU7A 3MM4A 1JWLA 4K8ZA 4JS5A 3HP9A 4PZ0A 1I39A 1UWBA 2F8SA 5KTQA 1S9EA 5KQMA 3G1WA 3KCNA 4MYRA 4RWEA 1NK5A 1D2AA 1TL1A 3GRCA 4Y1CA 3OYLA 4ICLA 2Y1JA 1TKDA 4E7LA 4RY0A 4I2QA 4MFBA 3KLFA 1JHZA 4MPTA 2VUIB 3SJJA 3OM0A 4MR8B 2HJ9A 1W25A 4PA1A 4MR7B 3OMWA 1JKHA 3DLGA 1E2BA 3WNHA 1D5WA 3NH1A 4CERA 3WNFA 3OYAA 3G85A 3AA3A 4CEOA 3QEIA 4C8MA 1OXBB 4FJGA 3EYZA 1PNRA 4Q0BA 4AILC 3KLGA 4LH4A 1TAUA 1T05A 3LUCA 4YGXB 4YS6A 4RSMA 4FK0A 4FZXC 5HQJA 4M3RA 3DLHA 4BDZA 4MS4A 2Z1JA 1S6QA 1QP0A 3AO3A 3NF9A 3RVJA 2MYPA 4Y1DA 4FJLA 1CXUA 3SZ2A 5TQ0B 2CWDA 4MLDA 1VSMA 4MR8A 2DFEA 3SQNA 2XRIA 4MR7A 3OQNA 4NH3A 4LZLA 2XHBA 2FLKA 3MF4A 4KFCA 5E3JA 1SRRA 2OYQA 3SYZA 4DQRA 2VWJA 1RTJA 4CK3A 3MIZA 4ZJPA 3O3GA 2H0AA 5JNRA 3JVDA 4CEBA 2F96A 3Q7SA 4M42A 4E7IA 4DFKA 5FRMA 3SUNA 4CCHA 3NF7A 1SXHA 4H60A 3QNOA 1MB0A 4DSEA 3LKVA 1F51E 3CG7A 4BWMA 1EX4A 4KB0A 3VA3A 4M3ZA 3DLRA 3K2PA 1Z26A 3Q15C 4ETMA 3ZCMA 3DBIA 1DP4A 1Z2EA 2QKBA 4IFYA
chains in the Genus database with same CATH superfamily
4AICA 5GIPA 2C1XA 4V0OA 2Q4TA 5GAEP 3IAUA 4KBGA 1F6BA 3C3XA 4NGDA 4F21A 4HPJB 1P0MA 1QC5B 3FW1A 3NF8A 3V1OA 1HDEA 4DJJA 1CC1S 5J2TA 5DASA 4LF9B 1U6JA 1JPJA 1Y3AA 2GZ1A 1NJ6A 2WYHA 2AMFA 1I0IA 3IIJA 1K88A 1DINA 3OFSA 2PUFA 4WK0B 3WJ1A 3GK3A 2O4IA 1ESVA 3LY8A 4RTRA 1PS0A 1WVMA 1RCUA 1T4DA 1CF9A 4FBLA 4M0PA 3VF2A 2ZYWX 4FWKA 3I6YA 7YASA 3C1TA 1KFDA 3NORA 4IKOA 4DTXA 1P4HA 3K96A 2W40A 1JP7A 2LBPA 5EJ8A 4HWKA 3IUCA 5CH3A 1V5FA 1LPOA 4UVEA 5HYVA 3CLRD 5K3EA 1GGFA 3UFXB 4ZYXA 2DKOA 2H1VA 1IJEA 1E2GA 5G53C 2PXAA 3JQDA 4MS1A 4ARAA 5BSGA 2BSAA 1W581 2OP1A 2V96A 5EQTA 2JH8A 2CMDA 1Z68A 1W4ZA 1JDUA 2JGKA 3PDWA 4MGHA 1JB1A 3HTVA 1IH7A 4OGFA 2QQEA 2X9GA 1KJ8A 3TZQA 5M1PA 1I5RA 3NETA 4KMRA 1VLVA 4LMBA 4YV2A 4CGZA 1WMFA 3RQSA 2VJMA 1PO7A 4X8LA 1BWFO 3TLCA 1K2VN 1NQTA 4L4RA 3VOSA 2ZR0A 3DDCA 2GJ4A 3O5BA 3A58B 3T5TA 4FSDA 4R8KA 3L8GA 2A41A 1KY2A 4UUMA 2E3JA 3TW0A 4ZQGA 1JBQA 3ZDCA 4ND6A 5JC1A 3CJAA 4NGBA 1WRBA 3ZHYA 5CFQA 4F5ZA 5AQIA 4TMXA 1FJGB 4RGBA 1N2JA 3FJOA 4KHPK 4I5GA 4F8JA 5BWCA 4LXUA 2H1IA 1GPUA 4C1BA 4DR3B 1U63A 5FWXA 2WFZA 2FWIA 2WF8A 4EA8A 2GH1A 1V37A 1CUAA 3UMFA 2JWLA 5CHYA 4FOLA 2YVAA 2XGOA 3DYBA 1MH1A 3ONVA 1KJIA 4I5IA 5J3JA 3TI0A 4FSXA 3KJQA 4UVGA 4Y1GA 3BORA 4UPDA 2HIAA 3NATA 3TBKA 2X0NA 1B26A 1VI6A 1QNFA 2QZPA 4ENQA 2C99A 3I9V6 1JLBA 4JKCA 2VQSA 5E4YA 3Q0TA 2P6PA 2YJ3A 3UGQA 1G16A 3HP6A 3LVRE 3ZGOA 1O94D 4YXWA 4D9MA 1V8OA 4YCMA 3U6KA 1XTSA 3QVGA 4HTUA 2Y1FA 3ASUA 2V45A 1SH7A 2QI9C 3I76A 4C0HA 4IEIA 4I6GA 1X9HA 2FK7A 3TAMA 4RMJA 3R5TA 5HKLA 1RTKA 5JMTA 5I9NA 1U0FA 3VVLA 4HNSA 3KSDO 5J4HA 3HUFA 2ZJAA 3O0TA 1ZL0A 1AU9A 2YYYA 1YQTA 5EJFA 3HKDA 1RKBA 4QDKA 4ZQFA 3AKDA 2SHKA 1YBVA 1KIFA 4D3FA 3MC1A 4RBNA 1ILWA 3ERCA 5BY2A 3DEYX 3LP0A 3ZWAA 4JYMA 5H16A 3KL4A 4ALIA 3MA0A 1EESA 5BR8K 3GFTA 2R3SA 1HQYE 1NI4B 3OBIA 1TECE 3I0SA 2EWMA 3I32A 1K92A 4B9SA 3OOSA 4IHJF 1BIZA 1FFYA 4B3TK 3PXCX 3UUEA 2C1ZA 2Q6IA 4CE6A 4DPLA 1H5UA 1H93A 3TD9A 2G8FA 1X7HA 3DXYA 2IPLA 5IKXA 3LZJA 1W5TA 1ECJA 1X19A 4CM1A 4LF8K 1OFTA 1S9HA 1ZOPA 4BNHA 2PZSA 2ZUCA 3O7MA 4F5YA 1X7XB 1EMDA 4BQPA 3IHWA 2PD4A 5LQAA 1SZ2A 1E6WA 2JC3A 2OUKA 4U2FA 5TT1A 2JFPA 4WH0A 4IDGA 4YIHA 4HTFA 2NVUB 3CONA 3JY6A 3VMMA 2AFIA 2HLDA 1JFTA 3ZWCA 4FM2A 1YZ3A 1GYQA 4CZJA 4B1FA 1U8TA 4RUKA 3B13B 3DRRA 4YO8A 1H2AS 3DJFA 1XTUA 1NXQA 4RV4A 5BNZA 1N3LA 5HR5A 1ZCAA 1NJSA 4DADA 3FYUB 1V8DA 3AVGA 1T9GR 2BFEA 4IHJB 4EUFA 5FBZA 3PGMA 3OLWA 4EP4A 1Z4KA 1BX3A 4TS4A 2CC2A 3H7IA 4V38A 2Y93A 1QKJA 1R16A 1S2OA 4X24A 3QOXA 2V4UA 5FHQA 2BI4A 5IT4A 4NZPA 3CUEF 2IC5A 3BD7A 4UEOA 3OU7A 1N2IA 4HHEA 4G84A 3QXSA 1R6DA 3M1AA 1QQAA 4DPMA 1NVTA 3LBAA 1KVAA 1IEVA 3KZMA 5J5VA 2XITA 4AD8A 3WIDA 2UYCA 1Z2DA 3TW4A 1L5HB 1T3HA 2G0AA 2RC5A 2PE5A 2YNMD 2P3OA 3IQXA 3QEJA 5TGTA 5IM4A 4HWGA 5ALRA 3BXPA 4DSJA 3LK7A 4EUEA 3KQUA 2F3PA 3EXFA 4XRRA 4YWJA 1KHHA 1GKIA 2QSJA 3IAEA 4UTOA 3K30A 4C4ZA 4XTRA 3KTFA 3TZHA 1CETA 2RGYA 5DM2A 5DGIA 1P61B 1ONNA 4JYAB 3ULEB 4LI3X 1GSAA 3A3YA 1U7WA 2DB9A 5A04A 2XCLA 3EGXB 3DUFA 2J0EA 2GETA 5F5XA 1KLNA 1Y9ZA 2D06A 2KMLA 2KW5A 4HQLA 2BHLA 3TLZA 5IFLA 3EG9A 4RVSA 2WDZA 1MENA 1VI5A 1QHNA 1G8FA 4IXCA 2QJTA 2KZZA 2OC4A 4RPLA 2ZEJA 1B41A 3VERA 5IH7A 4QJIA 4S1NA 3QKRB 1E3EA 2JKZA 3ID6C 3BJZA 4BL5A 3S68A 3BGOS 4RTSA 4ZRMA 5JBNA 3FI9A 5ALUA 4QTTB 2ZAOA 3K7EA 2X41A 4D42A 3PA6A 4IIEA 3KK2A 1WSBA 2X0FA 4ENWA 3KQWA 3AO2A 3L41A 3LWLA 5TARA 1U2QA 4RA9B 4M0CA 4IV8A 3FNBA 4JYZA 1ZA2A 2D8MA 2IXBA 1SVNA 5HRCA 4DMGA 3QELA 2PO5A 4RW4A 2AC7A 4F4DA 1G6OA 4C6HA 4HLDA 1XNHA 4TS3A 2ORIA 1DKOA 3AB3A 4RHTA 4O2BF 2VDNB 4EFDA 4KN6A 1ZUD1 1UK9A 1UR5A 4M9RA 2ST1A 2CGKA 4FHZA 2G77B 4EM6A 3IMKA 4DG8A 4QXRA 4QWMA 2ORED 5AVJA 4C7BA 4HQNA 3B12A 1TUBA 5H81A 1XZDA 1GSIA 4TMKA 3D6UA 5AWFC 3RIEA 4JLKA 3BM5A 3T06B 3B60A 2RGBA 3D6TB 4P58A 4DTNA 1VSDA 1EJ6A 3C4JA 2HK6A 2ASEA 1VTKA 5HPYB 4WI1A 2DUMA 1FC0A 1SK8A 1V45E 1VQ7N 5AYVA 3AT1A 4MK4A 2BANA 4AHTA 3CM0A 4DR7K 2H2DA 1XO1A 5G0TA 3LHSA 3QMVA 4L73A 1QH8A 4M1EA 4V02A 1NRJB 4QA9A 1SQ5A 1PR2A 3LUPA 1XDWA 4EI2A 1JBEA 2MIIA 1YQ9A 1WW2A 4TM8A 4O2BB 2WJGA 3TECE 3RPEA 4DARA 3U4QA 3F98A 3TTDA 4I0WB 2NZWA 3DEFA 5I48A 2W6OA 1Y8RB 3U3OA 5K6RA 2CHFA 2UVQA 3N87A 3ZSRA 3CXCM 3REGA 3KNZA 4Q18A 5CU7A 5GONF 3AFMA 3CX6A 3HEAA 1A9XB 5FTNA 3OIGA 1FU8A 4G24A 4RL6A 2A5DA 2GPNA 4YT2A 3AR9A 1DOAA 5JC8A 4YOWA 1XPJA 2W4IA 5KJCA 1W5BA 2FPGB 2YMMA 2ZVJA 5U4QA 3Q87B 4D4KA 1N3BA 1E18A 4MITA 2FSJA 5C24A 4C6TA 2CVFA 2O0MA 3LBFA 3H2BA 5DK4A 2R8PA 4O3MA 4HL6A 3G9QA 1ENZA 3RWUA 4J9UE 3U3JA 2EZUA 2WWTA 3IRVA 4DNXA 3INGA 1EI9A 3ND6A 3CWQA 1IO2A 3EZXA 4M9CA 4W5WA 2D0AA 1UPXA 4BNLA 1V39A 2XT9A 2C07A 4CEJB 3GJZA 4GMHA 1W0HA 1J9ZA 4P53A 2WHXA 4GSLA 3PQEA 3VR6H 1TLTA 1J5EB 1TU4A 4C29A 3SMSA 4J0JA 1RNLA 1QG2A 1D8TA 3LL7A 1TCVA 1A2OA 4GD3Q 1IZ9A 5GONB 3FETA 1J39A 3F1KA 4EJ0A 4ENUA 4XEIA 4OFWA 4JP5A 2ZUWA 4AJ2A 3LF1A 4MVYA 1QHTA 1X15A 4KQFA 1UPFA 3RSFA 4IJAA 5DLYA 3LF2A 1DBVO 1P44A 4ZZ1A 1J99A 3FKJA 3QWBA 1P80A 1PKEA 3SXUB 4OXQA 2H2WA 2JEYA 2V6GA 4PLFA 1NULA 4IYJA 3AIMA 4DC9A 4E5SA 3QBTA 2DHQA 4QBTA 3VYTB 4AHVA 4MCAA 4BY9E 4GGPA 2C9DA 2IU4A 4HSEA 4K1XA 2XQKA 5JZBA 5HIMA 5L7WA 4AVYA 2PBFA 1KRXA 3D8NA 3JAWB 3C6AA 2XGMA 4PY2A 2QPLA 4UDYX 5F1XA 2UXBB 3U19A 3WC4A 4BLTA 5IC4A 4KOEC 3VSCA 3EXEA 2BFCB 3ZLJA 1LZLA 2ZSDA 4V19S 4RD4A 2E2OA 4DJFC 3NDJA 4R2HA 2OYRA 3QNWA 2IV3A 4YT4A 4BNFA 4ZK6A 3MTBA 3HNOA 1XCPA 3D4LA 1BU6O 1AMUA 3EXHB 2V7WA 3K6SA 1KI3A 2VJOA 1YKSA 3G10A 3CNHA 1FMLA 5IK2A 2W7TA 3BZBA 3IPXA 3Q5DA 3Q98A 4BTVA 1Q9XA 3KR0A 1IRXA 3QHPA 4XB6B 3PXAA 1VE6A 3AK4A 1IV0A 2PMFA 2WPDD 3L82B 1H8EA 2GTIA 4MQLA 1R0SA 2RGGA 4B1ZA 1LV7A 3P97A 2R0QC 2DHEA 2HY7A 2VT6A 4KTWA 1L3UA 3IQWA 3NTUA 3E0XA 4AJ4A 4PG4A 3EF3A 1M1NA 4DMKA 4EIAA 1N1DA 5K0ZA 3FGUA 1GNQA 4A7PA 4CCYB 4XQ0A 2JIZA 1A98A 3O6WA 3G8CA 4CM9A 3H9JA 1R8JA 5EY4A 5GADl 1NT2A 3GXOA 1FP6A 3WLTA 5IF3A 1L5KA 4FIZA 5BVHA 2C5HA 2YXPX 1LX6A 2R48A 5HK9A 3CUKA 4XX0B 5JMPA 1YU9A 4U9UA 5KRSA 1UP6A 3PUHA 4P8RA 4CLDA 1NGIA 1GYRA 3SSNA 3JQPA 1PFQA 1H9CA 3KWFA 4DA8A 1EBBA 3NIGB 4BRZA 1LAWA 3K5HA 3UGKA 4JI5K 3KUKA 1RZRA 3C14C 3Q9UA 1B14A 2L0XA 5EWJB 1J1ZA 2XYPA 4U6QA 3ZEAA 3PGLA 3FI0A 2XXBA 1YB4A 5C1PA 1HLPA 3SVZA 1Q18A 3RG8A 2AOUB 3DE4X 4NG4A 5EX5A 3DBHB 3D4NA 3IUBA 4OI0A 4LC0A 4C7KA 3KKQA 2Q6VA 3EOAI 1GZ6A 5BN5B 3N2ZB 5EEGA 1X7WA 2HO4A 5KU1A 1DUVG 1IATA 1EX1A 3UHJA 5KC9A 5KJ6A 3RUFA 2O9JA 1RXVA 4BQRA 4RELA 2A30A 4LXXA 1YUBA 4D6XA 2N42A 1IUPA 2VRWA 5LQNA 3W5BA 1T5OA 3N2GA 5EJ4A 2W4MA 3KQKA 4XOIA 3DHWC 4RFVA 3ZY4A 1VXRA 3LX5A 4M45A 4IYRA 3LLCA 4LXGA 3K8OE 4IOJA 3A6GA 3PI6A 4MPJA 4BPBA 3OIVA 2ODNA 4HB4A 5L3QA 3KB8A 2Y1DA 5TIIA 3U7RA 1H6BA 1EHIA 4CFCA 3TB4A 2IBMA 1NLMA 1U1GA 4HX9A 3MT9A 1SUIA 1N6QA 1RDCA 2RONA 3L1UA 1IN4A 2R751 1NLUA 2RN2A 2QWPA 4A6PA 5AZIB 4FMBB 4R8LA 2A35A 4XWTA 1QE3A 2CN1A 3LRPA 3WKCA 4EKIA 4CTJA 3T8YA 1JJ2M 4B48A 1BXZA 4RVOA 1I6WA 1QKKA 4Z4GA 4I4CA 3M70A 1S1VA 4FLUA 4GBGA 3CCJN 1G7CA 1IG9A 1NMNA 4KH5A 3IXQA 5I8ZA 3T5MA 1YWGO 4L5CA 1RT7A 3DXMA 4Y2GA 4JBIA 1Y9DA 3RUCA 5FTJA 5KNCA 3QV1A 5JU6A 3ESRA 2OV3A 1NAIA 1BN7A 1AUXA 5IDWA 3LIIA 4XH5A 3H0EA 1C8LA 3MXTA 2VBGA 3OQOA 9MHTA 2A0UA 4BV2A 4B4VA 1TTQB 2ZGYA 4JSTA 3CF6R 2IOHA 1S5JA 4PCAA 3M6UA 1Y4UA 4Y6OA 1RPAA 1R0XA 4AO6A 1AHHA 3I23A 1O89A 4YV0A 2AFHE 4I5FA 1BQNA 3L2RA 4C7OA 2RGEA 4M9ZA 1TVRA 2VK2A 4N03A 3TTXA 4GQAA 1LW2A 2ZB7A 2DU8A 4QTZA 5AVXA 5KQGA 4Z1OA 5K6AA 4UAJA 1ADCA 3V42A 1E9FA 2LCQA 4KLRA 5SY9A 2AJBA 2NZJA 5BT8A 3DYIA 4IDDA 1KORA 1ZRMA 5DBHX 3HYFA 2IOFA 2R9VA 1SBNE 1HPLA 1MDFA 5FOTA 3ZSYA 4HB0A 3SHOA 4CMAA 1VMDA 4C8NA 3MWYW 1ZQ9A 4CF1A 5EGSA 5C3MA 5ITZA 3R7BA 3NIBA 3G25A 3L92A 1GOAA 4MWCA 2PGLA 1MZPA 2C5SA 2JFHA 4G37A 4C4PA 2BUAA 4J2TA 3I28A 3PQ3A 5IASA 3WLHA 3P2OA 1T03A 3LY7A 3RS7A 2A3ZA 4PTYA 4ALMA 2JD1A 4YJFA 4JD2B 4BNXA 1RDFA 4GW6A 2FUG1 3EVCA 4DAEA 1HMVA 1I4TD 3DV2A 5K3AA 3I9KA 3CE6A 4UOZA 4BVJA 4CD3A 3LD9A 3VGJA 4A5BA 4EA7A 1NF3A 4EI8A 4WQ5A 5JMWA 2YWEA 2EKBA 1GGEA 3MJCA 3FN4A 1PDVA 3BK2A 3ZY6A 3RBAA 2E49A 3C6QA 1LBIA 5JFTA 1NBAA 3L40A 5AKEA 1JE1A 1G4AE 1NGCA 1CERA 3VU0A 2XE6A 3L93A 4IIDA 1GEEA 3HQ4O 3Q6NA 4CCSA 3N2YA 1G8HA 2BC9A 2E5WA 1J8YF 2PO7A 2IP4A 1F20A 2XKBA 2PX8A 4N0DA 4CF3A 2PSSA 4D82A 3MM4A 4DHYA 4OQMA 1G3QA 3O3NB 1UWBA 2B6NA 2F8SA 5IW8A 1ENPA 2ISQA 1TKDA 1SCIA 3HU1A 4UFPA 4GI2A 2ZE7A 4MFBA 1EM8B 1TNDA 3OM0A 1HYGA 5CA1F 3T3EA 1EH5A 1A9SA 4DEXA 2O3JA 4WKNA 1P19A 4U1RA 2PJDA 3VNUA 3NIWA 4XFJA 2BCGY 2V9ZA 1OWLA 5EJAA 2FFBA 4QUEA 3H04A 5ALQA 4GR5A 2NNLD 2VKQA 4M2LA 3KOOA 1QZZA 5HRAA 1L4NA 3ZYYX 2Q2RA 4GECA 4DTIA 4PLCA 1NHGA 4X64B 1GPDG 5TC4A 4ZQIA 3TAXA 4AZ0B 1Q57A 3I12A 2QG4A 4TMWA 3BGSA 5BMVF 1WXHA 4KVZA 2J0UA 3RU2A 1XTTA 3GLHA 4L8LA 1VBNA 3FD8A 1U0EA 4LSMA 2SKCA 1F1BA 4WN3A 2CLDX 2WIJA 4JMLA 4B3SB 2RGXA 5JFGA 4NYJQ 1E9DA 2FPOA 4PLYA 3JVDA 3I37X 1I1OA 4CCHA 5EP1A 3MMXA 4DV6B 4NMXB 1F4PA 1OBHA 3A4VA 3ZCMA 2Q29A 1KDTA 4HDSA 1OY1A 5CA1B 3W34A 2J7PA 4N1AA 4H7FA 4RU1A 4IHQA 1A8SA 4MV9A 1R6VA 5F76A 2A92A 1TAGA 1V5EA 1G66A 5ELLA 2GWKA 4YBRA 2TS1A 1L5QA 4NS4A 4R5PA 3EOBI 3FYUC 5BXYA 3CMAN 2FPLA 3L7BA 1IIBA 2AVNA 5BMVB 1OLUB 1ATZA 5BPFA 2FRVA 4U2EA 4BVFA 3ZU5A 3RJTA 2V7QA 4CFAA 1ZL2A 4S2EA 1Q1QA 4GOKA 2WYIA 2CUTA 1PJAA 4WK2B 3SEAA 3TI9A 5IX8A 2MMCA 4QDZA 1FF9A 1Z5OA 3INYA 1NMZA 4ITRC 4KJZA 2VRNA 4LJKA 2I3DA 3DFZA 3EBPA 1GUBA 3GGJA 1YVUA 3BFJA 3HB4X 3K16A 1Q0PA 4J7AA 1QHHB 1SOMA 3P20A 4R1SA 3WYGA 2YVUA 2QRPA 4Z54A 2XV1A 4P7BA 1YL5A 5DOZA 3L4KA 3ZDXB 4EY7A 2ZUBA 3G7SA 5H5JA 2YHIA 2FOLA 4B17A 5PGMA 3L05A 4WJLA 1WZEA 3KSUA 5CEFA 3DGEC 3G2JA 1X7DA 4JR2A 3SI7A 1TB4A 1GLLO 4BMZA 3WNZA 4DQQA 4PQGA 1WW3A 3CT6A 1GUDA 4HWIA 3BCRA 3FIUA 4TWJA 2GBCA 3FR8A 3DF9A 5THQA 3OM1A 5I01A 4NE2A 1UA1A 3EEBA 4URUR 4A2PA 4ID1A 3E48A 3VR4A 3GF4A 1LJ8A 2B1RA 4CLRB 1YK1A 4EGCB 1R00A 4KQEA 3AGRA 3DAYA 5KAPA 1VK0A 2ZJ5A 4Y2YA 3Q3VA 5HQ3B 3H16A 2FBXA 1A9TA 1IHXA 3EVFA 2F1JA 2CDBA 4L4ZA 1FYVA 4GQBA 1KJWA 5ALDA 1WX1A 4IZHA 2ZDQA 4BJ6A 4BVLA 1N6LA 3KM0A 2IYQA 4BNZA 4O59O 2A3NA 5L4LA 2G5GX 3K05A 1L4KA 2ODEA 2GEVA 4OQXA 1HFEL 5E2BA 4E3WA 3KE9A 3HA7A 3G2LA 3JQ7A 5J59A 1I10A 2BEUB 3P4XA 3PL1A 3KEMA 3DEZA 3UJ6A 3T7IA 2NV2B 4PCLA 3V8BA 1P1CA 4JGIA 4NPAA 3FYHA 2BEVB 2J3HA 2DWPA 4CHPA 1EU1A 4BKOA 5GZ6A 3EXIB 3WMGA 3VR2D 2F8TA 3S1AA 4HWOA 2Z4TA 5G4KA 4HV4A 1XHXA 1R18A 3Q9LA 4XRGA 3KQTA 5ER6A 3VQ4A 1T8SA 4X9XA 3W8FA 2PSHA 2VPZA 3AA5X 4MICA 3OP4A 4J0CA 1PDOA 3CLSC 1IWOA 4WOBA 1U4BA 2B36A 2IZ6A 5GPBA 2AKYA 1DEAA 3RKSA 3WISA 4HUTA 4C2AA 2DC1A 2JLSA 4TRRA 2YVLA 1I3AA 1QSSA 1UBUS 1Z5UA 2PKQP 4NOLA 4KO4S 2QD1A 5E41A 2F9LA 1CR2A 3RDPA 3GFRA 3W78A 5F0XA 421PA 3FNQA 4YAJA 4O63O 4RTOA 1KZ7B 3HN6A 5DNCA 3HUUA 1OFVA 5DM60 1KBZA 3G9UA 2JLVA 1PWHA 4NK5A 3PUJA 3KETA 3GIWA 1BE8A 1D6MA 4HQFA 1DI0A 5EZYF 2C2ZA 1OKJA 1MRZA 3KBBA 3R8EA 4ZCMA 1E2EA 4RH0A 2GD6A 2IF2A 2PYIA 4GMJB 1R9MA 2Q5FA 3AHHA 3TOSA 4HYYA 3ADBA 1UBFA 4IJWA 4OREX 1JFFA 3WLOA 1KAEA 2ZYDA 3U61B 1J8FA 3VKGA 3RC9A 4MO9A 3V2IA 2D0OA 2C1EA 3F0TA 2ZYTX 4D96A 3KSZO 4H7JA 1Y1TA 3AGPA 3NBMA 5BV8A 4B71A 1N1GA 3FZYA 3HDJA 1H66A 2BBWA 5CA0F 5C1BA 4FE7A 4DCOA 3I9V1 5BUQA 3PV0A 4FNGA 1MJHA 2RG1A 1ORRA 1OH5A 1Z29A 1ZU4A 3A3OA 2NPFA 2OEPA 2AD5A 1JE0A 5KNLA 1YB7A 2YRXA 4HRXA 1RXCA 4QVGA 4G0WA 1M7BA 4GL4A 2EBHX 1OFHA 2CB9A 1E0JA 2SCUA 1IY9A 3AV0B 1J07A 5DMRA 1SELA 1G5RA 1X1RA 2MYNA 4AX8A 3FFBA 4I55F 5EZYB 4BLSA 1E6MA 3EK2A 4PQEA 2OANA 1GZ3A 6ADHA 4JJ6A 2Z2ZA 3A8YA 4L5YA 4QLAA 3JSXA 4Y9UA 3VUFA 2R11A 4HT3B 4ITVA 1J2RA 4EW3A 1CUGA 3R9PA 2BE7A 1RRKA 2VJBA 3JSAA 3JQGB 3AZPA 4O6VA 2P4UA 1EAYA 4EHIA 1NP7A 4NATA 4IDQA 4KK3A 1ZVQA 1BAPA 1C81A 4DVGA 4E0DA 1SCQA 1OPRA 2H1LA 5CA0B 2ZT8A 2Z2IA 1QTNA 3NTRA 1L5LA 4BBAA 5KYTA 3F3KA 1CJUC 2IIVA 3HCPA 1ZLXA 4JT4A 3GBSA 1L5ZA 1FU7A 1ZGCA 2RGNC 2YWGA 3RSOA 2BTEA 3COJA 3GCXA 3KOMA 3RC1A 1C2TA 3SOPA 3I53A 4CT5A 3GAZA 4FB5A 2VSYA 2YKNA 4YCDA 1FW8A 4I55B 3HBFA 2X2OA 1ML4A 2FR8A 2J3EA 3VQ7A 1ZUIA 4O5BA 3VQBA 4JAXA 2WAMA 4JS4A 4D4GA 2RK3A 4TWRA 4IZ9A 2CY0A 3G2MA 1F8XA 3ENOA 4KC0A 2O7QA 3EMVA 4FLEA 2J6IA 1D03A 3OLYA 2IX9A 3UGJA 4DIBA 3HA5A 3BZUA 2JZNA 3KKNA 5DBGA 4LAFA 3KSMA 4RHYA 4WXMA 1XZLA 4X20A 2WU8A 3WZMA 3RUDA 4O0JA 3B9BA 1EK1A 1Z4JA 2PD3A 5DLEA 3DH0A 2QW8A 3S2ZA 1JQEA 3F7MA 4B4WA 3M2PA 1R0YA 2F9FA 2QD3A 3P71T 4EVSA 3PEVA 3UK2A 2I3BA 2UXDK 4E94A 3QPVA 2X0EA 4DLVA 1GITA 4LSWA 3HOSA 3C5EA 1BMQA 4E5DA 2OZLA 1XX6A 1K6IA 1BXGA 3O1LA 2ZE2A 1DVRA 1NVAA 3U7QA 3AUJB 2FNAA 4FPXA 2I55A 3W2TA 3HXMA 1J70A 1WUHS 2L17A 2FF3B 1OBOA 2J59A 2P2NA 2IPAB 5EKXA 1K9VF 4IGFA 4RZUA 1ZG3A 4GOND 3MTAA 1Y48E 2GCPA 4QT0A 3LAMA 1WETA 2XA9A 4IG4A 2R79A 1XQ1A 2NXJA 1MB9A 1Y82A 3DV0B 4PEVA 5JS2A 1ZCZA 5FRNA 5A6VA 1ZXBA 5F3WB 3LP3A 1JDBB 3QUTA 4BQLA 3C45A 3P9SA 2FUG6 1NK7A 4HB2A 5KNDA 4F7WA 3FSGD 1TK2A 3NHPA 3WL7A 3SBDA 2CJFA 5EPEA 3WDKA 3AR8A 1N6IA 5F2OA 5HJ5A 1JJAA 1VSKA 4KH6A 4R54A 1ECGA 3HACA 5LQRA 1GPJA 2H2HA 4FWMA 3H05A 4Z8XA 4YOUA 3K8YA 5A9SA 3KAKA 3LFHA 4JK9A 1FSSA 2IIQA 1EVKA 4DV4B 1BE0A 3P0HA 4XVRA 1C9KA 2MR5A 4D0SA 4D6PA 1ECCA 4TLMB 2C96A 3HMKA 1XAIA 5E4FA 1P6XA 1D4FA 5AM3A 1K3FA 2QWOA 2JCSA 3OMXA 1ZBUA 5E9JA 3RVRA 5ALEA 2IQIA 2O6HA 4AN0A 3CZ9A 3GMIA 4JEPA 2KE5A 2NU8A 4OFXA 4OI4A 2B98A 4LYDA 1Y4SA 2EP5A 2I6XA 2CEAA 5JCJA 3HPHA 3U39A 4CJFA 4C0WA 3CG0A 4PKHA 4DTMA 3MCVA 1AKUA 1L3CA 2I4LA 4H18A 4HLCA 3CX3A 5LDGA 1OA1A 1KFJB 1RPTA 2OM2A 4KBFA 3QPAA 5ILQA 4BUCA 3UWMA 2RHMA 1J6ZA 2V4MA 1ZH0A 1I80A 3D6NB 1SXJD 4EG7A 1ABEA 3W5IA 4DIOA 3VC1A 4KKVA 1NQVA 4H1VA 2FSVA 2W2QA 1BDGA 2X22A 2I6TA 3CW2A 1IK6A 1U6IA 4G1MB 2FYTA 3V9PA 2BJWA 2DQSA 4P4SB 1HYHA 4DUZK 3ZSZA 4JLUA 2JFUA 1TTPB 3ZD8A 1U4SA 4LFAK 2HC9A 3GMTA 3KP1A 3L1VA 1GFZA 4AJOA 2JGLA 3L0OA 1Y4AE 2VQDA 4BLUA 1C3VA 1PJTA 2F3QA 4L8WB 2YHSA 1HEYA 2GK3A 4RE5A 1DBSA 4ZARA 1I8TA 5TQ2A 4JC0A 2XT0A 3PHJA 3ADPA 1G3MA 1CY0A 3IUMA 2CXOA 2GCEA 4RFLA 1XQSC 4Z5XA 1UIRA 2E1PA 2FP4A 1MX9A 1XZCA 3E27A 1SD1A 2LRHA 3JU3A 4M1OA 3MTQA 4GHWA 2GK6A 4HJRA 3FFAA 1J2YA 1MABA 5G1OA 1E3LA 2GTDA 1QGAA 2WUSA 3B38A 4BACA 5EVJA 4BE9A 3UANA 3JYQA 2QLLA 4BC2A 4BX9A 1I32A 5D1HA 1WCXA 2VAVA 3QTBA 3W5AA 2NRXA 2XRMA 3DDZX 2X4DA 4LA4A 2MHCA 4JVOA 4YDUA 4XSHA 1EZ4A 3TKAA 3JATA 3F2VA 2DKFA 2Q2VA 5B1IA 1PRYA 4WEOA 4OKSA 3C8MA 1OQAA 3W2FA 4YQEA 4QM7A 1UBHS 4Q03A 1RHRA 1D0SA 4IUBS 3A6FA 1FLNA 2WMYA 5LMZA 1G41A 4ZCIA 2CNLA 5BPNA 1SXJE 1COWD 2ZJ0A 5ALMA 3P2YA 1U9ZA 4KAAA 3SC2B 2QS9A 1QPBA 3C85A 2ZJRL 4UCFA 3PQCA 5KJ1A 1KOFA 3C39A 4YJ2A 1PX2A 3B78A 2FHSA 1S3SA 3T1VA 3E1GA 2XWSA 3DF7A 3HVTA 3CIFA 4L4YA 2ID4A 1AZLA 1JH9A 3I2KA 3AR6A 3DFKA 4JEMA 1E4OA 3ONDA 4R9RA 1PVVA 3CF4G 4BZXA 2Q1UA 1YS2X 3O8NA 1RLJA 5AR0A 1SCKA 2W8BB 2ZRHA 1ODJA 3Q6IA 3BCUA 2IYVA 4LXTA 4PS1A 3OHRA 4HP8A 3WGZA 1G7TA 2AOVA 1YTLA 4NBNA 2BJVA 4M6WB 4LVCA 1N2ZA 1ZAKA 2CLMB 1ZM3A 3K9WA 2HHXA 2O2EA 1DAPA 1V7CA 4Z9BA 4NYJR 2GK7A 2Q4DA 2QVXX 3QLVA 4ZVRA 3R2JA 5TGDA 3V4PB 5G3YA 1HPMA 1JIUA 3EZGA 2DPGA 1P74A 3C3DA 2ZIGA 4V0RA 2EFHB 1R5NA 2QW1A 3H4IA 3ICVA 2E87A 2PS0A 4DUPA 2P6MA 2PVPA 4Q4CA 4HLNA 1DHRA 1T4GA 4F6LA 2X2PA 3E5MA 4P3OA 5ADWA 4NYFA 4I3HA 5BUSA 1EUZA 1T9DA 2GHTA 2WP8J 3CNOA 4AMUA 4ATNA 5KTTA 5KKCA 5LNK1 1VG8A 3ZJYA 1E3SA 3N2LA 4GVPA 1WOMA 3GT7A 2YJ6A 3OJOA 4OUDB 4ZC8A 2VJYA 3A7EA 4NSNA 3IAXA 3OQIB 1L3SA 5CX1A 1NXOA 5DGCA 2AJTA 1WY5A 4EEKA 3ZT2A 1K0UA 1A9OA 4IGIA 2BJHA 5DRTA 2Y0DA 1UZUA 2GFHA 4N65A 1K08A 3W79A 3LVFO 4RK6A 3WLMA 4NJEA 1E7WA 3NM6B 1D09A 3LX6A 4WK6A 4CK1A 3L2UA 5L6LB 1YOBA 5BVGB 3NHMA 4EB0A 2RI6A 4CDNA 2GDJA 2VWBA 4EHKA 3WNEA 5CD1A 2FQYA 4WESB 1OLOA 2W6PA 4YJKA 3WGIA 5AM5A 3F5QA 3L0YA 4DA0A 1F9EA 1AHIA 2QT1A 4UMDA 1EP1B 3BMQA 4FQ5A 1R50A 4NMMA 3BAFA 3QITA 1D1PA 4MKHA 4HGZA 4MAAA 1G2PA 3B48A 2XY5A 1BDMA 1W35A 2HMSA 4NCKA 4FGSA 1IHDA 4P84A 4PGGA 4MKGA 5AVTA 2HMPA 3RKRA 5EJGA 1JX6A 1LNSA 4LY7A 1QLJA 5DW3A 4EAQA 1G5HA 3HSSA 1KZ6A 4JHLA 4RW9A 4I6JA 3WNDA 2FPIB 3BCSA 1WXQA 3DULA 5JVDF 2ET6A 2Q5CA 2W83A 4J4HA 1T5BA 3IDOA 3WLEA 2XY7A 1XXHA 4I1RA 2VG6A 1DKGD 3QEOA 1DTWA 5D5PA 1C4OA 4DSLA 3J80A 1DXYA 1IQ0A 4BC5A 4XB1A 4PYIA 3I2HA 4GXQA 3FUCA 3CZCA 1JPUA 2UZIR 2XRYA 3PIPL 4BIIA 1U8FO 1E63A 4KFUA 3CCVN 4RTQA 5J23A 2NUPA 3LQ4A 1ZRHA 4MGIR 3GO4A 1L8XA 1KVRA 4ND3A 4I1YA 4AUMA 3SDBA 3P0RA 4MYDA 4GV9A 1WMAA 1D9FA 1RJFA 3I4CA 3RRXA 3GBVA 3GVXA 3PWKA 3WYAA 4F2WA 1DV2A 4A6XA 2I29A 2ZYAA 4EF5A 5CR4A 3K6RA 1SU8A 5CVDA 1JA1A 4XH4A 5CBKA 4W7IA 3PHIA 2B35A 4PC6A 4CTKA 2PBZA 2Y27A 5JVDB 4L0CA 5G2OA 1HKBA 4OGGA 4PHFA 2VF8A 2WJYA 5L53A 2ZIAA 4WUVA 1D8AA 1DV1A 1JPNA 1XP5A 2BE2A 2YHBA 3HXTA 1MZVA 4DCTA 1HG0A 3FHLA 2FG7C 1YQUA 3H5RA 4DDMA 2F4NA 2ZBDA 2FN9A 4RZSA 3OIFA 4D0GA 2OAP1 4NARA 2OG1A 3QSGA 1M8FA 2VHJA 3M8KA 1Y9EA 1QRUA 1OAOA 4UCXA 4X65B 4BVGA 3G1WA 5ERGB 1AUVA 3GL1A 1W29A 4I2QA 2BD0A 4QBHA 1XJCA 2DBZA 3O5AA 2HJ9A 1J49A 1HDYA 3CCUN 1RQ2A 2QY9A 3EF1A 4X7RA 2ATIA 5DXFA 5EXTA 4BX3A 3UCEA 1K7CA 1PNRA 4Q21A 5LBUA 5KNBA 2XGGA 2QN6A 1AKYA 1UDBA 2FZLA 3KALA 2Z0MA 3DOEA 2W4QA 1T05A 4IJ6A 4RSMA 1C80A 4OQYA 4OXYA 2ALJA 2PFSA 1QGDA 2CGEA 3P4YA 2CXTA 2G76A 1FU4A 4FYIA 4J16A 1HX1A 4Z3KA 5EFZA 2CWDA 3WYEA 3W5CA 5E8JA 5D01A 2QAGB 3WWEA 5DHAA 2H92A 3ND8A 4IG9A 2CV0A 1TIKA 3HC7A 2NRVA 2VWJA 3GDOA 3TEFA 5EESA 2C20A 1U2EA 1XQ9A 2VHYA 3CUTA 1XSEA 3SP1A 2WWYA 1M6NA 3MFQA 3HDTA 4P4NA 2CLCX 1MNQA 3KWMA 4KPGA 3S5UA 3CVOA 1QGUA 3WLLA 2Q7OE 2HTEA 4KN9S 3GNSA 3JALB 1ECPA 1YL7A 2AD1A 3RSHA 4KHSA 4PFSA 3O94A 2OBYA 3C3KA 3UK0A 2QJWA 4NBSA 5SZKB 4G81A 3QO9A 2I62A 1M7GA 1HNZB 1CPYA 2ISSD 1M2HA 2QUJA 1SUDA 3WRWA 5IT5A 1MRNA 1RC1A 1QHSA 2G9NA 3LFUA 2HPZA 3VKFA 4PG7A 3ENWA 1XEFA 2QPAA 5EZSA 5HLFA 4MVJF 1MAVA 1T8TA 4HR7A 5FPPA 5AW4A 4C1NK 4GLBA 1XMPA 2GB4A 2VTDA 4PPYA 4IR7A 1KIAA 2Z8ZA 4ZPXA 4O5FA 1VFPA 2ESRA 4HADA 2IU3A 5DYIA 3DDUA 1X9SA 5AZJB 4P3PA 3RKUA 5AVUA 4LIPD 2BTFA 1PFYA 1GADO 2NXWA 2H48A 3FNRA 5LQDA 1ESNA 4GI1A 1KI7A 2NRRA 3GGCA 4DSOA 4CE9A 4HYQA 2V0CA 4Z7QB 4NE7A 4BFLA 4OQZA 3UJ8A 3GFBA 2JCVA 4V24A 2A1UA 1CLQA 3N39C 1J53A 2CLKB 2GEUA 3MECA 1F17A 3CGGA 5HDBB 3RGWS 4DRXA 1Q82O 4TPKA 3VSBA 5C8XA 1XTRA 4TZTA 4URYR 5CT6A 1UZAA 3D3NA 3Q3CA 4LHEA 1JEJA 3JCZA 4BEVA 1HNNA 1E5XA 1BXRB 3LCCA 4DJEC 5EE5B 4J76A 1JDNA 3IA2A 1H6DA 4N40A 4HZUB 3VEYA 2C97A 5HQTA 5CMLA 1YJ9N 2WJZB 4WACA 2YOHA 4ARVA 2Y1OA 3AFOA 4OJKA 3KWLA 4HUGA 3T7CA 1CY8A 4I7FA 4CW7A 3SJCA 2IEBA 2OHFA 2XSZD 3NE6A 3JQ8B 4B3OA 3SXJA 4K3UA 1QO0D 1AIPA 3NTXA 3DFIA 1TF5A 3U7GA 1OZHA 4RESA 2VP4A 2BM9A 4F4IA 2XUHA 4FTWA 5CHIA 3Q12A 1HQDA 1YZKA 3P9PA 1SAYA 1NMYA 2QX8A 3GHHA 3LHDA 1TJ4A 4LQDA 1BFDA 2MYUA 5KYXA 2VF5X 4Z4QA 2KLBA 2WHPA 1JCGA 2W6ZA 3AR4A 3SS8A 4FDLA 2WMDA 4PLHA 3LW8A 2IYRA 3WQBA 1MQAA 3KQMA 3EMKA 4FGWA 5KWVA 2PVSA 4DM4A 4ZPJA 1RFQA 4LC1A 3C6KA 3EMBA 1XYVA 1G8YA 3TSOA 2IVFA 3ABOB 3PRHA 4RABA 4FJ5A 3ABRB 1VHDA 2GYYA 2QZ9A 3LT5A 1SD5A 1W8DA 4MS3B 3E7PA 4JUIA 3IV6A 3KYBA 2AG0A 1I7NA 1SEVA 1MF7A 5JFOA 4A6DA 4A9AA 2UU9B 1FUYB 4OLBA 3R41A 3NT2A 2HCJB 4XVHA 4Y30A 3L2WA 3MAJA 1JAIA 1O8BA 3FG9A 1I33A 3NBQA 3W2HA 3OCXA 3CQ8A 1SA0A 4LPKA 3BSWA 2W9XA 2AI1A 2BHNA 1Z0DA 2LGJA 1W47A 1BMDA 1K63A 3LUHA 3I8BA 4TXMA 2OCBA 5CK4A 2N47A 2JI6A 1LH0A 4I9LA 5FL3A 5MFPA 1U2RA 5KB3A 4URFA 4ZA2A 1IBMB 2R00C 3VR3D 2ZXFA 1E2PA 1UINA 3F5SA 4DF4A 1E79A 4TKZA 3VZDA 1ZOLA 1P5ZB 2G7MC 3KPJA 1NBWB 5C3UA 1XRSB 3ZJUA 2ABWA 3C1OA 2DR2A 1U3GA 3CH4B 3EUEA 1V1MA 4LHZA 2Q2NA 4R16A 4ZOCA 5AVWA 2AFVA 4AHRA 2ICAA 2O8DB 1ZD8A 1SKYB 3R8CA 4OAQA 2ZDHA 1V4TA 1VIYA 3ZU3A 3MXIA 4NEGA 1HNWB 5A0VA 4F04A 4GKKK 3OPXA 1AKNA 4AIRA 1BOTO 1NFQA 4EY5A 1JVNA 1WE2A 1KPIA 3K0CA 3R7AA 1Z0AA 5F23A 4YAGA 4HMOA 1HKHA 1BISA 5ESWA 1UZMA 1CS0B 1QRTA 1TV6A 2F55A 2A4KA 4DU1A 4HFMA 3L2OB 4ZEXA 3NEPX 3ZV4A 5CYMA 2ZWAA 5FOQA 2IA5A 2CNWD 4WCFA 1FNCA 3DMNA 1QYVA 4XWYA 3QWIA 1KR2A 3JWGA 1S2GA 1QO7A 2QLBA 4CKBB 1LBQA 1T8PA 3DOCA 4ROSA 4K9DA 3H5TA 1D1SA 3EPPA 4B7XA 1UXHA 3GVIA 4YCSA 3BH7A 4CV3A 3SXPA 5KU7A 3E7FA 3JYPA 3E4CA 3C4QA 4ZVNA 2B4YA 1Q14A 3RFXA 1UBNA 3L8HA 4Q9LA 3MTEA 2HJSA 5K0EA 3L0CA 4BRFA 5TV2A 4KQMA 3LPUA 4ZJUA 2JGFA 2A42A 1G9TA 4I81A 4RJKA 2YWRA 3FNGA 1AUQA 4QNMA 3G2OA 5B4TA 3GG2A 1XUOA 3BE6A 1F9AA 2G4CA 4IDKA 2GZSA 4PC1A 2M6RA 4IOAL 5LNK6 4KI7A 4AQDA 4PZCA 4J29A 4YWHA 4DQVA 1MAWA 4ZYZA 1RTHA 3GEEA 1ZZEA 2G1UA 4IF4A 4HS9A 3FHTA 1KQNA 1JHDA 2JI7A 5LKAA 1JSRA 2WUVA 1Y1RA 1ZBIA 5EJ2A 2FG5A 5KX5A 3G88A 4DLYA 1SKSA 2AK2A 2J48A 3PTLA 5AM1A 3CXUA 3A2KA 3H1QA 2V5VA 1NF8A 3ZCRA 1QTQA 1O58A 4ZQCB 4TMYA 2YV0X 2J9FB 3K9FC 3HXOA 2B8EA 1F2UA 2OV6A 2H51A 5FPMA 3ZNOA 3G89A 2COKA 2EAUA 2JDID 4PUOA 4KQCA 5DTEA 4QQ8A 2ENUA 4AURA 1X2BA 1U5AA 3CYMA 2WSIA 4KNYA 3FCYA 4HDNA 3VQAA 4FOSA 1X8JA 1D0VA 2HLNA 3F9KA 1ZKDA 3CZRA 1ABFA 2MTBA 3ESZA 5K5EA 3JARB 3C7CB 1VE3A 2ZSKA 1MORA 3SY8A 1UEIA 1VCIA 1F8YA 5KPTA 4R2XA 2OLKA 1RP7A 4EG0A 4UUAA 1B76A 2FQ1A 4PXYA 3C2QA 3PDIA 3IKLA 1JQJC 1N75A 3SUOA 3TQHA 4CGIA 5JSQA 1PUJA 4RTFD 5LMUK 2HK8A 3GP8A 4HUQA 1HNVA 3IR7A 1J7KA 4R51A 1XU9A 2NSJA 4NHOA 1XQYA 4MB0A 2ZAGA 3MEGA 2Q41A 2QK9A 4EG4A 2C5BA 5K51A 4PHCA 3QM1A 2PUTA 4OHYA 4IIHA 3VXKA 3H6EA 2W2LD 2PAAA 2WG2A 1WCIA 4JHDA 4BRQA 4DBLE 3WWYA 3J7AC 5BPMA 2HREA 4BO6A 3LT2A 4H6VA 2NTEA 2O3RA 4ZQHA 1YMQA 1SVIA 2RAPA 2I6GA 5I9SA 4DHEA 5JAUA 4EJ2A 4V0SA 2GZ2A 1DFIA 2FKNA 4N6GA 3URMA 3ZIAD 1RYEA 3TVYA 3RSGA 2JLRA 4JX9A 4R3UC 2Q9BA 4FYDA 1NZJA 1BGVA 1U2ZA 5D5HA 4DLRA 3L6BA 1U5CA 3D0PA 2VDRB 1V7PC 1Q5PA 1TZ2A 4NZ9A 3DVLA 1XVUA 2EIHA 1TD9A 4BNTA 1ISSA 5B58C 2QRHA 1OYWA 3S2FA 1U3UA 2VNSA 1PZNA 3L49A 3WK8A 4MEBA 4C0KA 1Z6AA 1W36B 1WPQA 1QE0A 4NDAA 2HRZA 3DHNA 3D3KA 3GL9A 5I6DA 1Q7BA 3GWZA 2C4WA 1CVLA 2BFFB 3GLSA 3UOGA 1CY1A 4D9HA 3L7NA 3ROGA 3AI1A 5AM4A 5HE8A 2DF8A 5F7XA 5LMCA 1KZ1A 4MGKR 2ZYSA 1E9RA 1G8KA 1SZDA 3GLKA 3QVUA 2ONZA 4ZMRA 1M8JA 3RYTC 3PQ6A 1JEAA 3SGLA 2OFPA 2PK3A 2WSSA 1CXZA 1I2AA 5AQEA 4TSFD 5ESXA 3ZGZA 2X4GA 4KUHA 3SVTA 1PD0A 4D9CA 4WDQA 1J2JA 3T52A 5FLXO 3WDLA 1J2TA 3WX0A 4LDNA 2O06A 2HUNA 1QE5A 3O38A 4IWXA 2K5UA 4E2XA 3AJ8A 4J0QA 1AMOA 3OTOB 3IBTA 4X1IA 2QAIA 3O2NA 3K53A 3PS9A 1Z17A 5KHAA 1R37A 3RBXA 1DIBA 4FYHA 1B6GA 3T99A 4AS1A 2WRZA 4CJVA 4MQFB 3VPSA 3I2GA 3PYLA 4IDOA 1YDHA 2PT6A 3AEUA 5I42A 1IJJA 3OJXA 2JFOA 3H1AA 4C5AA 2YNGA 3O3OB 4MP8A 1QZ5A 3A6ZA 4MKXA 4TV9B 2X1HA 3KD2A 2JVKA 1JG4A 2IUSA 2IGIA 4J2DA 4LYAA 5CAEA 2RCYA 3OIYA 2R4UA 3I3SR 1VCOA 3OS0A 4IO0A 1KVUA 4JJZA 1XLTA 2FW9A 4ZFNA 4L3VA 3MMPA 4P1ZA 3DB1A 3KYIB 3HCNA 1ZGHA 1XZBA 2Q3LA 5J43A 2IIPA 4PAQA 3FUUA 1DUSA 3MWJA 3L1JA 3HK2A 4CEQA 1K7XB 3GT0A 3WXBA 4A0SA 4A92A 1TQ2A 3BWYA 4Q9HA 3KT6A 3QRWA 1EIZA 1A1SA 4ZT6A 5JAOA 1JG2A 2EFYA 3U13A 3UUFA 1TT5B 3M4XA 4H6WA 3T7JA 4KREA 3TSCA 2V9PA 4U4AA 4EY6A 3RRMA 1GRNA 1V11A 1LU9A 1KMMA 8MHTA 3M5CA 3GYBA 4C89A 3GJRA 4JQCA 3HKCA 4KHNA 1ULAA 1MQ9A 2MU1A 1R6UA 3ELBA 1QUFA 1P9OA 3AM5A 4HI0E 2J5XA 2NO0A 2RDMA 4AS3A 3OYDA 3WAGA 4ZI7F 3BXZA 3AR3A 2DP4E 2D74A 4LN1A 1UK6A 2WFMA 2GA8A 1THTA 5D85A 3ZCVA 4HXYA 4DN6A 2VHEA 5CM2Z 5CHEA 4HKTA 3DTVD 4MQ4A 3M8QA 2OLJA 1I3OA 2B5VA 4KR3A 2JJ2A 5ENZA 1PTKA 4Z53A 3A6LA 5H9VA 4B6RA 4YV7A 1LUAA 1YJ5A 2XHZA 3WAJA 3UHPA 1DWPA 1OV6A 1ULZA 4PBSA 1WB9A 2YXLA 4LJ4A 1SURA 4PGFA 4M87A 1GNLA 3EDQA 1HDXA 4GMKA 4V1CA 4HNUA 2AMLA 3VA0A 1U28C 4H3HB 1V25A 3R6LA 2HJRA 4NK4A 4YYEA 4P3YA 2FCRA 3DCYA 1YMUA 5IJ0A 2QMZA 5FNVA 2NVWA 1QKIA 1QCYA 1KMNA 1NUHA 4ZI7B 2YJ5A 3BWCA 3A5NC 4X8HA 2JJ1A 4HAVA 2KBEA 4M3TA 5M1OA 1BYIA 1MJGA 2A33A 3PUXA 1YJNN 3BDPA 2W5UA 2QE7D 3O6EX 2AYXA 3OUTA 1I36A 3ZHZA 3WIBA 3KOXA 3P27A 2LV8A 2PUHA 2W22A 2I65A 1M1YA 1UT5A 5AKLA 3CY6A 4XJTA 2ZRCA 2HDNB 4YOXA 5K3DA 2Q62A 1L5GB 4G4SO 4EHAA 1XKLA 5B1SA 1ZGGA 2PMCA 3SFZA 4JD5A 4GI3A 2IUTA 3TH5A 4KZKA 4Z0NA 1GN8A 2CNBA 3D3EA 1A4IA 1PFWA 1Y4ZA 4RD3A 5C15A 4ZYVA 2X6NA 4DYVA 1UKYA 1QJ4A 4X94A 1I30A 3IEPA 3W5DA 1KA9H 1FLDA 3B82A 1GTZA 2O8FB 3RS9A 4Q9NA 5DSXA 1AZTA 2X40A 3V1QA 4KO2S 3DBLB 1PZFA 5CJJA 4PAOA 2QVZX 1YB5A 3Q7CA 1RABA 2GPYA 4YP9A 1U8ZA 1R9NA 5HP4A 3NR2A 1WF3A 2HF9A 1QFXA 1G21B 5FTWA 1A7KA 3UWSA 2XOKA 1GPLA 1VIMA 3L7AA 3LOPA 4PSVA 4ZO4A 4FR2A 1RT3A 4OLJA 5BNFA 4KGZA 4TTVA 3FUVA 2O8EB 1N77A 4JLHA 2P40A 3R7FA 1UOEA 1UBCA 4PN7A 4XIGS 3ICQB 4FVMA 3CXRA 1S89A 4RJTA 4JQZA 3CYFA 2QM8A 5FDFA 1ESCA 2RJOA 1AN0A 2BSQA 2REXB 2O23A 1HJRA 3WRYC 4S0XA 5K8VA 1SCNE 3EC7A 1DWOA 2XT6A 4QGGA 3T7EA 2UZ1A 4OM8A 1SC3A 4CUKA 1DQNA 2QTVA 3TXXA 1KFSA 2H31A 5IKMA 1PDWA 1P73A 2VNJA 2BM8A 3QPUA 4UD6A 3WWCA 5D3ZA 2P9UB 3OPQA 3V8EA 3MTJA 1RRPA 1HFWA 1AQJA 2AZTA 2QYTA 5FPNA 4OHVA 3LUDA 2HBLA 4MDFA 4HPXB 5DK6A 4A91A 5AM2A 4AZ3B 4BRKA 2YW9A 3BK1A 5C0OE 4B9VA 3SZGA 2BMVA 3FFKB 1DIRA 4OYYA 1M7HA 3I61A 3G8AA 221PA 4LRXA 5H70A 1KTIA 3CN7A 2HT6A 2H85A 1HZZC 2ATQA 1U9YA 2O4GA 1Z37A 3C7TA 5C25A 4BQEA 3C3PA 2V7GA 2RIPA 3C3AA 5AFUH 1BD3A 1YZVA 3ZSWA 2FEMA 3F49S 4IKFA 4KO1S 1XYGA 1E2KA 9ATCA 4CNBA 1NUTA 1FFHA 3OI7A 2JRCA 1FZQA 2MSDB 2EHJA 3NRCA 2JLUA 5CM8B 3CEAA 4BR4A 1KYZA 2BMFA 1S6PA 5AJYA 1ZMBA 2DSNA 3NANA 1VL0A 4Q3LA 3D45A 5EMNA 1R74A 4A57A 3RBVA 4IKPA 2G70A 5B1YA 4C4XA 3LWBA 2D1KA 2E5LB 3M49A 3I04M 3D6AA 1WXIA 1YB6A 3ZE2B 3OF2A 3W3AH 4YDSA 3ZSVA 4L02A 4HDKB 2Z8XA 1THGA 3JZFA 5ALWA 3STXA 1VJTA 2W8ZA 4KYVA 2BH1A 3AJ9A 1VSHA 1E1QA 3MRSA 2Y1CA 1QMGA 4PZ0A 2JS7A 2GXQA 5BSKA 1JECA 1MOPA 4R40A 5C7IO 1UPAA 1C50A 2V6IA 1V9CA 3B1FA 3L6QA 1JEYB 4XYMA 4E12A 1W97L 3FZFA 4M53A 3LDPA 4JKEA 2E88A 2ZRNA 1IOZA 5FCDA 5MLCQ 1XKQA 3UKUA 5FPDA 4CXMA 4PTLA 4Q0BA 3TI7A 4XTCS 4G09A 1C0PA 2QG6A 3IDFA 2QMYA 2PHZA 4H31A 4JP2A 1TDJA 4FZXC 1SU6A 1I01A 4ZD6A 2QF7A 3F6RA 4BMNA 4Q4JA 5JD4A 4G9ZA 3VH1A 2A1TR 3SNHA 1U5BB 3DAPA 5E1OA 2VEOA 1CZHA 1YJAA 2R97A 1FRNA 3OZSA 3T61A 2Y0CA 3TRKA 5B6PA 1XCJA 4ZJPA 4ZHQF 4YQYA 4M1ZA 1LW7A 2AH5A 1Z45A 2C4UA 1AKVA 4OA8A 5FI0B 1I4EB 1CVRA 3OETA 2PH7A 1FP2A 1OC4A 3WL4A 1RM4A 3V34A 1BQEA 5K3BA 4DSNA 1KQFA 4A15A 4TYPA 5IDXA 3E9CA 1AMNA 2NO5A 2V3WA 2ID8A 5BUCA 3WIEA 5TNXA 5ICMA 1AT1A 1YF5L 4WA7A 2QA4N 4PHTA 1ZYUA 2VDWA 1JZTA 2I22A 4L57A 5M5BA 1S2DA 2VYCA 1EDBA 3KQVA 3FPEA 3BHMA 3OQ1A 2UVPA 2HM7A 4ID9A 1NVWQ 3ACCA 1ASWA 2P9SB 2R8EA 4RS3A 4EP5A 3G5TA 1OX4A 1DCMA 3B8HA 2PUDA 3EXHC 1A9PA 2BGKA 5FPQA 2YQ4A 4BWJA 4OFZA 3HMQA 3NAGA 4A8JA 7REQA 3IUJA 4H0VB 3ASVA 4PAWA 1PSWA 3S2GA 3TNFA 4QICA 3T15A 1KH2A 1RJ9A 1VE5A 4J75A 4ZHQB 4FHDA 1OT5A 5G0SA 3RAPR 2HSZA 5UKDA 3OUZA 2VI5A 3AJEA 4BN0A 2VK8A 2FSKA 2UYTA 4L95C 4NFHA 3A3KA 2Z30A 4HN9A 4QJ5A 2QTNA 3FPLA 3DAFA 1ZBSA 3CNEA 1OLXA 4I6EA 4YPOA 2EKDA 3IEXA 3LI2A 1FS4A 3LQFA 3N2KB 2WF6A 4REOA 2Q5JA 3T3HA 1Z74A 5FAXA 4QJBA 2AEJA 4IWVA 1JXOA 3E66A 5F33A 3JQAA 3NYRA 5C1DA 2BGLA 3GRUA 3DLIA 4MXDA 2ZYGA 4JI4B 1WXXA 2X0RA 1UAXA 1PK7A 4DG9A 4NYIQ 3ZDZB 4GW3A 3WB9A 3QTTA 5LB4A 1M33A 2A4MA 3OTIA 3D0QA 3LKBA 4ILEA 2FFHA 1NKCA 3GRVA 2A57A 3F3SA 2H1OA 2X78A 5BR7A 3DEJA 4JU8A 4CTOA 2IQ5A 2WJVA 2D00A 2I54A 4EEXA 3U8XA 4EZ6A 2VGMA 1QNLA 5J4KA 5H59A 1KWGA 4O2AA 4ACBA 2WWVD 3C5HA 3JWJA 1KEUA 4I7EA 2AWNA 2O7RA 4FUQA 3E3LA 2D2FA 3E3AA 2VPPA 2B6HA 4WY2A 3WYNA 3V00A 1ND6A 2ZWPA 1O94A 2DTEA 3AP2A 4FWTA 5AHKA 1SUSA 1L7AA 1QIDA 4X84A 2WUWE 1N7HA 1HRKA 2RHDA 3RS0A 3O47A 4HBGA 4AJPA 5JJIA 3EGDB 2A5FA 2WIFA 4EFMA 4JVMA 3O9VA 1L5FA 1FQJA 4PSDA 4WW0A 1IDN1 2QV0A 2ZUTA 1XD8A 4HEQA 4KQXA 2ZKLA 3M6LA 4FFNA 3QX8A 4NBUA 4S05A 1M2VA 4YNQA 2XUAA 3OF5A 1H05A 1JAHA 1OGJA 1P4AA 4XW2A 4P35A 1YR3A 2D1QA 1BIFA 3ZQUA 2F8LA 4QELA 1FYDA 3FFTA 4XIYA 1HY3A 4CG3A 3CS3A 2W6KA 3OY2A 1KKUA 3RC3A 1JBKA 1M5TA 4IMIB 2XXJA 2HHWA 5JVGL 2J87A 4IF6A 4MW9A 4I1OA 3TCNA 2A1TS 3GCWA 4NS1A 4RV9A 5JSFA 4B3MB 1EG2A 1MJGM 2WG1A 3VEZA 3K9BA 4S04A 3ZZMA 2JJ8A 1LF0A 3ZSXA 3E9OA 1VKOA 4Q47A 1E4GT 4UPVA 3R6TA 1TEXA 4NICA 5C8ZA 4I50F 4EYKA 4F8EA 5L95A