6WPIB

Crystal structure of nop9 in complex with its1 rna
Total Genus 0
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
0
sequence length
44
structure length
39
Chain Sequence
AAUUGAAAAUGCUAAGGAUGAAAGUCUAUGCGUUUCAAC

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
molecule tags Rna binding protein/rna
molecule keywords Nucleolar protein 9
publication title Nop9 recognizes structured and single-stranded RNA elements of preribosomal RNA.
pubmed doi rcsb
source organism Saccharomyces cerevisiae (strain atcc 204508 / s288c)
structure length 39
sequence length 44
RNA BGSU Site RNA BGSU Site Entry
chains with identical sequence C
equivalent chains according to BGSU RNA Site 6wpi C
ec nomenclature
pdb deposition date 2020-04-27
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...