Found 2486 chains in Genus chains table. Displaying 1 - 50. Applied filters: Proteins

Search results query: dna binding protein/dna

Total Genus Sequence Length pdb Title
212 835 9n6iK 2.61 a s.cerevisiae chd1[l886g/l889g/l891g]-nucleosome 2:1 complex
222 835 9n6hK 2.54 a s.cerevisiae chd1[l886g/l889g/l891g]-nucleosome 1:1 complex
244 1144 9n6kK 2.88 a s.cerevisiae chd1[l886g/l889g/l891g]-nucleosome 2:1 complex with dna-binding domain
24 88 9n6iB 2.61 a s.cerevisiae chd1[l886g/l889g/l891g]-nucleosome 2:1 complex
29 98 9n6hA 2.54 a s.cerevisiae chd1[l886g/l889g/l891g]-nucleosome 1:1 complex
26 110 9n6kC 2.88 a s.cerevisiae chd1[l886g/l889g/l891g]-nucleosome 2:1 complex with dna-binding domain
29 110 9n6iC 2.61 a s.cerevisiae chd1[l886g/l889g/l891g]-nucleosome 2:1 complex
27 110 9n6hC 2.54 a s.cerevisiae chd1[l886g/l889g/l891g]-nucleosome 1:1 complex
31 94 9n6iD 2.61 a s.cerevisiae chd1[l886g/l889g/l891g]-nucleosome 2:1 complex
22 88 9n6kB 2.88 a s.cerevisiae chd1[l886g/l889g/l891g]-nucleosome 2:1 complex with dna-binding domain
34 94 9n6kD 2.88 a s.cerevisiae chd1[l886g/l889g/l891g]-nucleosome 2:1 complex with dna-binding domain
29 97 9n6kA 2.88 a s.cerevisiae chd1[l886g/l889g/l891g]-nucleosome 2:1 complex with dna-binding domain
30 100 9n6iA 2.61 a s.cerevisiae chd1[l886g/l889g/l891g]-nucleosome 2:1 complex
31 94 9n6hD 2.54 a s.cerevisiae chd1[l886g/l889g/l891g]-nucleosome 1:1 complex
25 88 9n6hB 2.54 a s.cerevisiae chd1[l886g/l889g/l891g]-nucleosome 1:1 complex
25 91 9cmbA Human pu.1 ets domain (165-270) bound to d(aataaaaggaagtggg)
164 502 9vdpA Cryo-em structure of the hexameric drt4
158 502 9vdoA Cryo-em structure of the substrate bound drt4
148 502 9vdvA Cryo-em structure of the catalytically inactive drt4
30 95 9kq2D Cryo-em structure of rnf168'-rnf168-ubch5c complex bound to nucleosome
25 83 9kq2B Cryo-em structure of rnf168'-rnf168-ubch5c complex bound to nucleosome
28 97 9kq2A Cryo-em structure of rnf168'-rnf168-ubch5c complex bound to nucleosome
27 102 9kq2C Cryo-em structure of rnf168'-rnf168-ubch5c complex bound to nucleosome
19 83 9kq2K Cryo-em structure of rnf168'-rnf168-ubch5c complex bound to nucleosome
60 237 9yzkC Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence acccttctatgacctactcca
68 232 9yzuC Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence atgagtcata and loaded with mutated bzip region of gcn4 transcription factor
14 57 9yzqD Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence tgatgagcag and loaded with engrailed homeodomain enhanced green fluorescent protein fusion
64 231 9z08C Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing separate insert strand with sequence gacggtaatt
66 231 9z4eC Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence catgagtcat and loaded with mutated bzip region of gcn4 transcription factor
10 25 9z4eD Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence catgagtcat and loaded with mutated bzip region of gcn4 transcription factor
15 58 9yzlD Isoreticular co-crystal of replication initiator protein repe54 and asymmetrical expanded duplex (31mer) containing the cognate repe54 sequence, and additional t-a rich sequence with 5' terminal phosphates. two copies of even-skipped homeodomain loaded post-crystallization
64 234 9yzqC Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence tgatgagcag and loaded with engrailed homeodomain enhanced green fluorescent protein fusion
71 234 9yzlC Isoreticular co-crystal of replication initiator protein repe54 and asymmetrical expanded duplex (31mer) containing the cognate repe54 sequence, and additional t-a rich sequence with 5' terminal phosphates. two copies of even-skipped homeodomain loaded post-crystallization
71 233 9yzaC Isoreticular co-crystal 1 of protein variant replication initiator protein repe54 (l53g, q54g, e55g) with symmetrical expanded duplex (31mer) containing insert sequence cccggccgga
11 25 9yzuD Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence atgagtcata and loaded with mutated bzip region of gcn4 transcription factor
142 671 9xyuA Ner complex - c7cad.atp
193 738 9xyuB Ner complex - c7cad.atp
10 52 9xyuH Ner complex - c7cad.atp
13 66 9xyuG Ner complex - c7cad.atp
115 446 9xyuD Ner complex - c7cad.atp
74 284 9xyuF Ner complex - c7cad.atp
87 380 9xyuE Ner complex - c7cad.atp
50 154 9xyuC Ner complex - c7cad.atp
33 172 9xyuK Ner complex - c7cad.atp
67 284 9pd4F Ner dual incision complex - duim
50 152 9pd4C Ner dual incision complex - duim
199 738 9pd3B Ner dual incision complex - duis
40 252 9pd4K Ner dual incision complex - duim
20 121 9pd4P Ner dual incision complex - duim
14 65 9pd4G Ner dual incision complex - duim