Found 28394 chains in Genus chains table. Displaying 3851 - 3900. Applied filters: Proteins

Search results query: Orthogonal Bundle

Total Genus Sequence Length pdb Title
23 71 4z5dA Hipb-o4 21mer complex
27 91 5ds9A Crystal structure of fis bound to 27bp dna f1-8a (aaattagtttgaattttgagctaattt)
27 82 5dnnB Nucleosome core particle containing adducts of gold(i)-triethylphosphane and ruthenium(ii)-toluene pta complexes
30 97 5dnnA Nucleosome core particle containing adducts of gold(i)-triethylphosphane and ruthenium(ii)-toluene pta complexes
47 140 5chzA Structure of wild-type human mbd4 bound to a g:t mismatch
19 86 5duiA Identification of a new foxo1 binding site that precludes creb binding at the glucose-6-phosphatase catalytic subunit gene promoter
24 72 4z5hA Hipb(s29a)-o2 20mer complex
47 126 5e01A Crystal structure of hinmlr, a merr family regulator lacking the sensor domain, bound to palyndromic promoter dna
151 435 5dqgA Crystal structure of human dna polymerase eta inserting dampnpp opposite o4-ethylthymidine
102 362 5d46A Structural basis for a new templated activity by terminal deoxynucleotidyl transferase: implications for v(d)j recombination
143 431 5dqiA Crystal structure of human dna polymerase eta extending an o4-ethylthymidine : da pair by inserting dctp opposite dg
40 144 5hlhA Crystal structure of the overoxidized abfr bound to dna
48 144 5hlgA Structure of reduced abfr bound to dna
25 78 5jrgB Crystal structure of the nucleosome containing the dna with tetrahydrofuran (thf)
36 97 5jrgD Crystal structure of the nucleosome containing the dna with tetrahydrofuran (thf)
30 105 5hdnA Crystal structure of heat shock factor1-dbd complex with ds-dna and ttt
32 99 5gsuA Crystal structure of nucleosome core particle consisting of human testis-specific histone variants, th2a and th2b
17 61 5hodA Structure of lhx4 transcription factor complexed with dna
32 98 5gt3A Crystal structure of nucleosome particle in the presence of human testis-specific histone variant, hth2b
27 79 5gsuB Crystal structure of nucleosome core particle consisting of human testis-specific histone variants, th2a and th2b
31 106 5gt3C Crystal structure of nucleosome particle in the presence of human testis-specific histone variant, hth2b
32 99 5gt0A Crystal structure of nucleosome complex with human testis-specific histone variants, th2a
53 138 5fb2A S. aureus mepr f27l mutant bound to oligodeoxyribonucleotide
111 327 5hhhA Structure of human dna polymerase beta host-guest complexed with the control g for n7-cbz-platination
30 106 5gt0C Crystal structure of nucleosome complex with human testis-specific histone variants, th2a
151 435 5f9nA Crystal structure of human dna polymerase eta inserting dcmpnpp across a dna template containing 1,n2-ethenodeoxyguanosine lesion
33 106 5gsuC Crystal structure of nucleosome core particle consisting of human testis-specific histone variants, th2a and th2b
25 79 5gt0B Crystal structure of nucleosome complex with human testis-specific histone variants, th2a
36 97 5gsuD Crystal structure of nucleosome core particle consisting of human testis-specific histone variants, th2a and th2b
98 329 5hhiA Structure of human dna polymerase beta host-guest complexed with cbz-platinated n7-g
27 81 5gt3B Crystal structure of nucleosome particle in the presence of human testis-specific histone variant, hth2b
38 95 5gt3D Crystal structure of nucleosome particle in the presence of human testis-specific histone variant, hth2b
143 435 5f9lA Crystal structure of human dna polymerase eta inserting dampnpp across a dna template containing 1,n2-ethenodeoxyguanosine lesion
69 190 5gpcA Structural analysis of fatty acid degradation regulator fadr from bacillus halodurans
20 61 5ef6A Structure of hoxb13 complex with methylated dna
581 2046 3hmjG Saccharomyces cerevisiae fas type i
212 536 5ildA Tobacco 5-epi-aristolochene synthase with mes buffer molecule and mg2+ ions
50 129 5ilcA The x-ray structure of the adduct formed in the reaction between hen egg white lysozyme a compound 2, a platin(ii) compound containing a o, s bidentate ligand
140 395 5it1A Streptomyces peucetius cyp105p2 complex with biphenyl compound
60 151 5iksA Wild-type sperm whale myoglobin with a fe-phenyl moiety
133 356 5j99A Ambient temperature transition state structure of arginine kinase - crystal 8/form i
83 306 5j9lA Crystal structure of cpt1691 bound to tak1-tab1
165 428 5j2tB Tubulin-vinblastine complex
143 439 5j2uA Tubulin-mmaf complex
162 473 5irqA Human cytochrome p450 17a1 bound to inhibitors (r)- and (s)- orteronel
81 193 5j1yA Structure of transcriptional regulatory repressor protein - ethr from mycobacterium tuberculosis in complex with 1-(pyrrolidin-1-yl)-3-(tetrahydrofuran-3-yl)propan-1-one at 1.81a resolution
114 338 5j1wA Crystal structure of human clk1 in complex with pyrido[3,4-g]quinazoline derivative zw31 (compound 14)
26 79 5iy5H Electron transfer complex of cytochrome c and cytochrome c oxidase at 2.0 angstrom resolution
82 193 5j1rA Structure of transcriptional regulatory repressor protein - ethr from mycobacterium tuberculosis in complex with 3-(furan-3-yl)-1-(pyrrolidin-1-yl)propan-1-one at 1.92a resolution
113 338 5j1vA Crystal structure of human clk1 in complex with pyrido[3,4-g]quinazoline derivative zw29 (compound 13)