1C0AB

Crystal structure of the e. coli aspartyl-trna synthetase : trnaasp : aspartyl-adenylate complex
Total Genus 3
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
3
sequence length
77
structure length
68
Chain Sequence
GGAGCGGAGUUCAGCGGAGAAUACCUGCCUUCACGCAGGGGUCGCGGGCGAGUCCCGCCGUUCCGCCA
Loading diagram...

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
molecule tags Ligase/rna
molecule keywords ASPARTYL TRNA
publication title Synthesis of aspartyl-tRNA(Asp) in Escherichia coli--a snapshot of the second step.
pubmed doi rcsb
source organism Escherichia coli
total genus 3
structure length 68
sequence length 77
RNA BGSU Site RNA BGSU Site Entry
equivalent chains according to BGSU RNA Site 1efw D 1efw C
ec nomenclature
pdb deposition date 1999-07-15
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...