1D4RC

29-mer fragment of human srp rna helix 6
Total Genus 0
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
0
sequence length
27
structure length
27
Chain Sequence
GUGACCUCCCGGGAGCGGGGGACCACU

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
publication title The 2 A structure of helix 6 of the human signal recognition particle RNA
pubmed doi rcsb
molecule tags Rna
molecule keywords 29-MER OF MODIFIED SRP RNA HELIX 6
structure length 27
sequence length 27
RNA BGSU Site RNA BGSU Site Entry
chains with identical sequence B
ec nomenclature
pdb deposition date 1999-10-05
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...