1MMSC

Crystal structure of the ribosomal protein l11-rna complex
Total Genus 5
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
5
sequence length
58
structure length
58
Chain Sequence
GCUGGGAUGUUGGCUUAGAAGCAGCCAUCAUUUAAAGAGUGCGUAACAGCUCACCAGC
Loading diagram...

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
molecule tags Ribosome
molecule keywords 23S RIBOSOMAL RNA
publication title A detailed view of a ribosomal active site: the structure of the L11-RNA complex.
pubmed doi rcsb
source organism Thermotoga maritima
total genus 5
structure length 58
sequence length 58
RNA BGSU Site RNA BGSU Site Entry
chains with identical sequence D
ec nomenclature
pdb deposition date 1999-04-14
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...