1NJP5

The crystal structure of the 50s large ribosomal subunit from deinococcus radiodurans complexed with a trna acceptor stem mimic (asm)
Total Genus 0
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
0
sequence length
34
structure length
24
Chain Sequence
GGGGCUAAGCCGCUUAGCUCCACC

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
molecule tags Ribosome
molecule keywords 23S ribosomal RNA
publication title Structural basis of the ribosomal machinery for Peptide bond formation, translocation, and nascent chain progression
pubmed doi rcsb
structure length 24
sequence length 34
RNA BGSU Site RNA BGSU Site Entry
equivalent chains according to BGSU RNA Site 1njm 5
ec nomenclature
pdb deposition date 2003-01-02
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...