1QZWB

Crystal structure of the complete core of archaeal srp and implications for inter-domain communication
Total Genus 0
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
0
sequence length
45
structure length
45
Chain Sequence
GCCGGGGGAACCGGCCAGGCCCGGAAGGGAGCAACCGUGCCCGGU

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
molecule tags Signaling protein/rna
molecule keywords 7S RNA
publication title Crystal structure of the complete core of archaeal signal recognition particle and implications for interdomain communication
pubmed doi rcsb
source organism Sulfolobus solfataricus
structure length 45
sequence length 45
RNA BGSU Site RNA BGSU Site Entry
chains with identical sequence D, F, H
ec nomenclature
pdb deposition date 2003-09-18
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...