1RLGC

Molecular basis of box c/d rna-protein interaction: co-crystal structure of the archaeal srnp intiation complex
Total Genus 0
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
0
sequence length
25
structure length
22
Chain Sequence
GCCGACCGAAAGGCGUGAGAGC

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
molecule tags Structural protein/rna
molecule keywords 25-MER
publication title Molecular Basis of Box C/D RNA-Protein Interactions; Cocrystal Structure of Archaeal L7Ae and a Box C/D RNA.
pubmed doi rcsb
source organism Archaeoglobus fulgidus
structure length 22
sequence length 25
RNA BGSU Site RNA BGSU Site Entry
chains with identical sequence D
ec nomenclature
pdb deposition date 2003-11-25
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...