1U63B

The structure of a ribosomal protein l1-mrna complex
Total Genus 1
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
1
sequence length
49
structure length
49
Chain Sequence
GGGAGUGAAGGAGGCUCGCGAACUCGCGAAGCCGAGAAACUUCACUCCC
Loading diagram...

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
molecule tags Transcription/rna
molecule keywords 49 NT FRAGMENT OF MRNA FOR L1
publication title Ribosomal protein L1 recognizes the same specific structural motif in its target sites on the autoregulatory mRNA and 23S rRNA.
pubmed doi rcsb
source organism Methanocaldococcus jannaschii
total genus 1
structure length 49
sequence length 49
RNA BGSU Site RNA BGSU Site Entry
chains with identical sequence D
ec nomenclature
pdb deposition date 2004-07-29
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...