2NR0E

Crystal structure of pseudoudirinde synthase trua in complex with leucyl trna
Total Genus 4
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
4
sequence length
81
structure length
80
Chain Sequence
CCGAGGUGGUGGAAUUGGUAGACACGCUACCUGAGGUGGUAGUGCCCAAUAGGGCUUACGGGUUCAAGUCCCGUCCUCGG
Loading diagram...

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
molecule tags Isomerase/rna
molecule keywords leucyl tRNA
publication title How U38, 39, and 40 of Many tRNAs Become the Targets for Pseudouridylation by TruA.
pubmed doi rcsb
source organism Escherichia coli k12
total genus 4
structure length 80
sequence length 81
RNA BGSU Site RNA BGSU Site Entry
chains with identical sequence F, G, H
equivalent chains according to BGSU RNA Site 2nre F
ec nomenclature
pdb deposition date 2006-11-01
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...