3IZ4A

Modified e. coli tmrna in the resume state with the trna-like domain in the ribosomal p site interacting with the smpb
Total Genus 15
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
15
sequence length
377
structure length
377
Chain Sequence
GGGGCUGAUUCUGGAUUCGACGGGAUUUGCGAAACCCAAGGUGCAUGCCGAGGGGCGGUUGGCCUCGUAAAAAGCCGCAAAAAAUAGUCGCAAACGACGAAAACUACCAUCAUCAUCAUCACAUGAGGAUCACCCAUGUAACGAUGAUGAUGCCUCUCUCCCUAGCCUCCGCUCUUAGGACGGGGAUCAAGAGAGGUCAAACCCAAAAGAGAUCGCGUGGAAGCCCUGCCUGGGGUUGAAGCGUUAAAACUUAAUCAGGCUAGUUUGUUAGUGGCGUGUCCGUCCGCAGCUGGCAAGCGAAUGUAAAGACUGACUAAGCAUGUAGUACCGAGGACGUAGGAAUUUCGGACGCGGGUUCAACUCCCGCCAGCUCCACC
Loading diagram...

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
publication title Visualizing the transfer-messenger RNA as the ribosome resumes translation.
pubmed doi rcsb
molecule keywords Modified E. coli transfer-messenger RNA
molecule tags Rna binding protein/rna
source organism Escherichia coli
total genus 15
structure length 377
sequence length 377
RNA BGSU Site RNA BGSU Site Entry
ec nomenclature
pdb deposition date 2010-09-21
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...