3NMUD

Crystal structure of substrate-bound halfmer box c/d rnp
Total Genus 0
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
0
sequence length
34
structure length
34
Chain Sequence
GCCGUUGAAGCUCUGACCGAAAGGCGUGAUGAGC

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
molecule tags Transferase/rna
molecule keywords NOP5/NOP56 related protein
publication title Structural basis for substrate placement by an archaeal box C/D ribonucleoprotein particle.
pubmed doi rcsb
source organism Pyrococcus furiosus
structure length 34
sequence length 34
RNA BGSU Site RNA BGSU Site Entry
chains with identical sequence E
ec nomenclature
pdb deposition date 2010-06-22
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...