3Q1RB

Crystal structure of a bacterial rnase p holoenzyme in complex with trna and in the presence of 5' leader
Total Genus 33
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
33
sequence length
347
structure length
347
Chain Sequence
GGAGAGGAGCAGGCGGUCGCGGGGGCGCACACCUGCGCUUCCCGAGGAAAGUCCGGACUCUGGAGCGGGGUGCCGGGUAACGCCCGGGAGGGGUGACCCUCGGACAGGGCCAUAGAGAAGAAGACCGCCCGGGGGGAAACUUCCGGGCAAGGGUGGAACGGUGGGGUAAGAGCCCACCAGCGUCGGGGCAACCCGGCGGCUUGGCAACCCCCACCUGGAGCAAGGCCAAGCAGGGGGUUGGGUCGCUCCCCCUAUUCCCCCGGGUUGGCCGCUUGAGGUGUGCGGUAACGCACACCCCAGAUUGAUGACCGCCCACGACAGAAUCCGGCUUAUGCUCCUCUCCCGUG
Loading diagram...

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
publication title Structure of a Bacterial Ribonuclease P Holoenzyme in Complex with tRNA.
pubmed doi rcsb
molecule keywords RNase P RNA
molecule tags Hydrolase/rna
source organism Thermotoga maritima
total genus 33
structure length 347
sequence length 347
RNA BGSU Site RNA BGSU Site Entry
ec nomenclature
pdb deposition date 2010-12-17
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...