3R9WB

Crystal structure of era in complex with mggdpnp and nucleotides 1506-1542 of 16s ribosomal rna
Total Genus 0
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
0
sequence length
34
structure length
34
Chain Sequence
CAACCGUAGGGGAACCUGCGGUUGGAUCACCUCC

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
molecule tags Hydrolase/rna
molecule keywords GTPase Era
publication title The Era GTPase recognizes the GAUCACCUCC sequence and binds helix 45 near the 3' end of 16S rRNA.
pubmed doi rcsb
source organism Aquifex aeolicus
structure length 34
sequence length 34
RNA BGSU Site RNA BGSU Site Entry
ec nomenclature
pdb deposition date 2011-03-26
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...