4D5Y3

Cryo-em structures of ribosomal 80s complexes with termination factors and cricket paralysis virus ires reveal the ires in the translocated state
Total Genus 5
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
5
sequence length
157
structure length
157
Chain Sequence
CGACUCUUAGCGGUGGAUCACUCGGCUCGUGCGUCGAUGAAGAACGCAGCUAGCUGCGAGAAUUAAUGUGAAUUGCAGGACACAUUGAUCAUCGACACUUCGAACGCACUUGCGGCCCCGGGUUCCUCCCGGGGCUACGCCUGUCUGAGCGUCGCUU
Loading diagram...

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
publication title Cryo-Em Structures of Ribosomal 80S Complexes with Termination Factors and Cricket Paralysis Virus Ires Reveal the Ires in the Translocated State
pubmed doi rcsb
molecule tags Ribosome
molecule keywords 60S RIBOSOMAL PROTEIN UL2
total genus 5
structure length 157
sequence length 157
RNA BGSU Site RNA BGSU Site Entry
ec nomenclature
pdb deposition date 2014-11-07
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...