4KZDR

Crystal structure of an rna aptamer in complex with fluorophore and fab
Total Genus 5
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
5
sequence length
83
structure length
83
Chain Sequence
GACGCGACCGAAAUGGUGAAGGACGGGUCCAGUGCGAAACACGCACUGUUGAGUAGAGUGUGAGCUCCGUAACUGGUCGCGUC
Loading diagram...

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
molecule tags Immune system/rna
molecule keywords BL3-6 Fab antibody, heavy chain
publication title A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore.
pubmed doi rcsb
source organism Mus musculus
total genus 5
structure length 83
sequence length 83
RNA BGSU Site RNA BGSU Site Entry
equivalent chains according to BGSU RNA Site 6b14 R 6b3k R 4kze R
ec nomenclature
pdb deposition date 2013-05-29
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...