4UE4A

Structural basis for targeting and elongation arrest of bacillus signal recognition particle
Total Genus 11
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
11
sequence length
266
structure length
266
Chain Sequence
GCCGUGCUAAGCGGGGAGGUAGCGGUGCCCUGUACCUGCAAUCCGCUCUAGCAGGGCCGAAUCCCUUCUCGAGGUUCGUUUACUUUAAGGCCUGCCUUAAGUAAGUGGUGUUGACGUUUGGGUCCUGCGCAAUGGGAAUUCAUGAACCAUGUCAGGUCCGGAAGGAAGCAGCAUUAAGUGAAACCUCUCAUGUGCCGCAGGGUUGCCUGGGCCGAGCUAACUGCUUAAGUAACGCUAGGGUAGCGAAUCGACAGAAGGUGCACGGU
Loading diagram...

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
publication title Translational Arrest by a Prokaryotic Signal Recognition Particle is Mediated by RNA Interactions.
pubmed doi rcsb
molecule keywords 6S RNA
molecule tags Translation
source organism Bacillus subtilis subsp. subtilis str. 168
total genus 11
structure length 266
sequence length 266
RNA BGSU Site RNA BGSU Site Entry
ec nomenclature
pdb deposition date 2014-12-15
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...