4V914

Kluyveromyces lactis 80s ribosome in complex with crpv-ires
Total Genus 6
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
6
sequence length
158
structure length
158
Chain Sequence
AAACUUUCAACAACGGAUCUCUUGGUUCUCGCAUCGAUGAAGAACGCAGCGAAAUGCGAUACGUAAUGUGAAUUGCAGAAUUCCGUGAAUCAUCGAAUCUUUGAACGCACAUUGCGCCCCUUGGUAUUCCAGGGGGCAUGCCUGUUUGAGCGUCAUUU
Loading diagram...

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
molecule tags Ribosome
molecule keywords 25S RRNA
publication title Initiation of Translation by Cricket Paralysis Virus Ires Requires its Translocation in the Ribosome.
pubmed doi rcsb
total genus 6
structure length 158
sequence length 158
RNA BGSU Site RNA BGSU Site Entry
ec nomenclature
pdb deposition date 2014-03-21
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...