4X4NB

Crystal structure of the a.fulgidus cca-adding enzyme in complex with a g70a arginyl-trna minihelix
Total Genus 0
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
0
sequence length
32
structure length
32
Chain Sequence
GGCCGCGGCAGGUUCGAAUCCUGCCGCGAUCG

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
molecule tags Transferase/rna
molecule keywords CCA-adding enzyme
publication title On-Enzyme Refolding Permits Small RNA and tRNA Surveillance by the CCA-Adding Enzyme.
pubmed doi rcsb
source organism Archaeoglobus fulgidus (strain atcc 49558 / vc-16 / dsm 4304 / jcm 9628 / nbrc 1
structure length 32
sequence length 32
RNA BGSU Site RNA BGSU Site Entry
chains with identical sequence D, G
ec nomenclature
pdb deposition date 2014-12-03
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...