4YCOD

E. coli dihydrouridine synthase c (dusc) in complex with trnaphe
Total Genus 6
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
6
sequence length
74
structure length
74
Chain Sequence
GCGCGGAUAGCUCAGUCGGUAGAGCAGGGGAUUGAAAAUCCCCGUGUCCUUGGUUCGAUUCCGAGUCCGCGCAC
Loading diagram...

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.


  Genus data interpretation
Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
molecule tags Oxidoreductase
molecule keywords tRNA-dihydrouridine synthase C
publication title Major reorientation of tRNA substrates defines specificity of dihydrouridine synthases.
pubmed doi rcsb
source organism Escherichia coli (strain k12)
total genus 6
structure length 74
sequence length 74
RNA BGSU Site RNA BGSU Site Entry
chains with identical sequence E, F
equivalent chains according to BGSU RNA Site 3foz C 4woi DW 5ndk X1 4v9h AV 3l0u A 2zm5 C 5ndk X4 4v5r CV 4v9d BV 4v5r AV 4v5p AV 4v5p CV 2zxu C 4v6f CC 5ndj X1 5ndj X4 4v5s CV 3foz D 4wqu BW 4v5q AV 4v5s AV 4w2e w 4v5e CV 6c5l AV 4wqf BW 5j4b 1y 4v5e AV 4v5q CV 4v5j CV 5w4k 1y 6c5l CV 5wit 1w 4v6f BC 5j4c 1w 5wis 1y 5j4c 1y 4v5d CV 4wqu DW 4v5d AV 5ndk W1 4wt1 1K 5wis 1w 4v51 AW 4wt1 3K 5j4b 1w 4v5j AV 4v9c AV 4wqf DW 5j4c 2w 5j4b 2w 5ndk W4 5j4b 2y 4woi AX 5w4k 1w 5j4c 2y 4wqr 3K 6nd5 1y 4w2g AW 5wis 2y 5wit 2w 4v9d AV 5doy 1y 2zm5 D 5w4k 2y 4y4p 1y 4wsd 1K 4z3s 1y 4wt1 3L 4v5s AW 5doy 1w 4v51 CW 4v6f BD 5doy 2y 6nd5 1w 4wqr 3L 4wsd 3L 4w2i AW 4v5s CW 4z3s 1w 4z3s 2y 4w2i CW 5w4k 2w 1vy4 AW 4wpo BY 6nd5 2y 4y4p 2y 4v5d CW 4v5l AV 4v5d AW 4wro 1K 4wsd 3K 5ndj W1 4wt1 1L 4w2g CW 4w2i AY 4w2f AW 4y4p 1w 4z3s 2w 4v5e CW 4v5d AY 4w2i CY 5ndj W4 1vy4 AY 4v5j CW 4wzo 3K 4w2g AY 4wpo DY 4v5d CY 4v5j AW 4v5q AW 4v5q CW 5wis 2w 2zxu D 5ndk V4 4wqr 1K 4v6f CD 5ndj V4 4w2g CY 4wzo 3L 5wit 1y 6c5l CW 6c5l AW 6nd5 2w 4w2f AY 4y4p 2w 4v6f CB 5doy 2w 1vy5 AW 1vy4 CY 4wsd 1L 5wit 2y 5ndk V1 4v5c AW 4wro 3L 4v5p AW 4w2f CW 4wro 1L 4v5r CW 4w2f CY 4v5c CY 4v5r AW 4v5c AY 4v6f BB 4wpo BW 4wro 3K 4v5p CW 1vy7 AY 5ndj V1 4p6f QW 1vy5 AY 4v5e AW 1vy4 CW 4v97 AW 4v4i z 4p6f XW 1vy7 CY 4v5c CW 1vy5 CW 1vy5 CY 4wqr 1L 4v97 CW 4wpo DW 4v5l AW 4v9c CV 4v8j AW 4w2h AY 4wqu BY 4w2h CY 4v8j CW 4w2e x 4wqu DY 4wqf BY 4wqf DY 3r8o V 3r8n V 5uym Y 5uq8 z 5wdt y 5wfs y 5we4 y 2jl7 V 2jl5 V 2jl7 W 2jl5 W 3jce 6 6bu8 Y 5uq7 z 5uyl Y 5iqr 4 5we6 y 5wfk y 6o9j v 5uyk Y 5kpx 30 5kpw 30 5wf0 y 3j73 S5 1vx2 5 3jce 9 5iqr 6 3jcd 8 3jcd 9
ec nomenclature
pdb deposition date 2015-02-20
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

  
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...
How to cite