The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.
Total Genus |
6
|
sequence length |
65
|
structure length |
60
|
Chain Sequence |
GCGUAGUUCAAUUGGUAGAGCACCGGUCAAAACCGGGGUGGGAGUUCGAGUCUCUCCGCC
|
The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.
After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.
molecule tags |
Oxidoreductase/rna
|
molecule keywords |
tRNA-dihydrouridine synthase C
|
publication title |
Major reorientation of tRNA substrates defines specificity of dihydrouridine synthases.
pubmed doi rcsb |
source organism |
Escherichia coli k-12
|
total genus |
6
|
structure length |
60
|
sequence length |
65
|
RNA BGSU Site |
RNA BGSU Site Entry
|
equivalent chains according to BGSU RNA Site |
4v5s AY
4v5r CY
4v5s CY
4v5r AY
4v5l AY
4v5q AY
4v5q CY
4v5p AY
4v5p CY
|
ec nomenclature | |
pdb deposition date | 2015-02-20 |
#similar chains in the Genus database (?% sequence similarity) ...loading similar chains, please wait... #similar chains, but unknotted ...loading similar chains, please wait... #similar chains in the pdb database (?% sequence similarity) ...loading similar chains, please wait...