4YCPB

E. coli dihydrouridine synthase c (dusc) in complex with trnatrp
Total Genus 6
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
6
sequence length
65
structure length
60
Chain Sequence
GCGUAGUUCAAUUGGUAGAGCACCGGUCAAAACCGGGGUGGGAGUUCGAGUCUCUCCGCC
Loading diagram...

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
molecule tags Oxidoreductase/rna
molecule keywords tRNA-dihydrouridine synthase C
publication title Major reorientation of tRNA substrates defines specificity of dihydrouridine synthases.
pubmed doi rcsb
source organism Escherichia coli k-12
total genus 6
structure length 60
sequence length 65
RNA BGSU Site RNA BGSU Site Entry
equivalent chains according to BGSU RNA Site 4v5s AY 4v5r CY 4v5s CY 4v5r AY 4v5l AY 4v5q AY 4v5q CY 4v5p AY 4v5p CY
ec nomenclature
pdb deposition date 2015-02-20
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...