5AXMP

Crystal structure of thg1 like protein (tlp) with trna(phe)
Total Genus 5
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
5
sequence length
72
structure length
72
Chain Sequence
GGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUCCCCAC
Loading diagram...

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
molecule tags Transferase/rna
molecule keywords tRNA(His)-5'-guanylyltransferase (Thg1) like protein
publication title Template-dependent nucleotide addition in the reverse (3'-5') direction by Thg1-like protein
pubmed doi rcsb
source organism Methanosarcina acetivorans
total genus 5
structure length 72
sequence length 72
RNA BGSU Site RNA BGSU Site Entry
equivalent chains according to BGSU RNA Site 5axn P 1ob2 B 4tna A 1ehz A 1i9v A 6gz5 Bw 6gz3 Bw 1tn1 A 1tn2 A 5m1j A3 6gqv AY 4tra A 6tna A 6gqb AX 1tra A
ec nomenclature
pdb deposition date 2015-07-31
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...