5ZEGC

Crystal structure of the bacterial a1408me1a-mutant ribosomal decoding site
Total Genus 0
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
0
sequence length
23
structure length
22
Chain Sequence
UUGCGUCCGUCGACGAAGUCGC

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
publication title A structural basis for the antibiotic resistance conferred by an N1-methylation of A1408 in 16S rRNA.
pubmed doi rcsb
molecule keywords RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*(1MA)P*CP*GP*UP*CP*GP*AP*CP*
molecule tags Rna
structure length 22
sequence length 23
RNA BGSU Site RNA BGSU Site Entry
chains with identical sequence A, B
ec nomenclature
pdb deposition date 2018-02-27
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...