6AAXB

Crystal structure of tfb1m and h45 with sam in homo sapiens
Total Genus 0
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
0
sequence length
28
structure length
28
Chain Sequence
GGUAAGUGUACUGGAAAGUGCACUUGCC

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
publication title Crystal structure of TFB1M and h45 with SAM in homo sapiens
rcsb
molecule tags Transferase/rna
source organism Homo sapiens
molecule keywords Dimethyladenosine transferase 1, mitochondrial
structure length 28
sequence length 28
RNA BGSU Site RNA BGSU Site Entry
chains with identical sequence D
equivalent chains according to BGSU RNA Site 6aax D
ec nomenclature
pdb deposition date 2018-07-19
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...