6ASOI

Structure of yeast u6 snrnp with 3'-phosphate terminated u6 rna
Total Genus 0
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
0
sequence length
80
structure length
69
Chain Sequence
CAAUUUGAAACAAUACAGAGAUGAUCAGCGGUUCCCCUGCAUAAGGGGAACCGUUUUACAAAGAGUUUU

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
molecule tags Splicing
molecule keywords U4/U6 snRNA-associated-splicing factor PRP24
publication title Architecture of the U6 snRNP reveals specific recognition of 3'-end processed U6 snRNA.
pubmed doi rcsb
source organism Saccharomyces cerevisiae
structure length 69
sequence length 80
RNA BGSU Site RNA BGSU Site Entry
equivalent chains according to BGSU RNA Site 5vsu I 5mps 6 5ylz D
ec nomenclature
pdb deposition date 2017-08-25
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...