6B48M

Cryo-em structure of type i-f crispr crrna-guided csy surveillance complex with bound anti-crispr protein acrf10
Total Genus 0
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
0
sequence length
60
structure length
60
Chain Sequence
CUAAGAAAUUCACGGCGGGCUUGAUGUCCGCGUCUACCUGGUUCACUGCCGUGUAGGCAG

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

molecule tags Immune system / rna
molecule keywords CRISPR-associated protein Csy1
publication title Cryo-EM Structures Reveal Mechanism and Inhibition of DNA Targeting by a CRISPR-Cas Surveillance Complex.
pubmed doi rcsb
source organism Pseudomonas aeruginosa (strain ucbpp-pa14)
structure length 60
sequence length 60
RNA BGSU Site RNA BGSU Site Entry
ec nomenclature
pdb deposition date 2017-09-25
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...