6FRK8

Structure of a prehandover mammalian ribosomal srp and srp receptor targeting complex
Total Genus 7
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
7
sequence length
156
structure length
156
Chain Sequence
CGACUCUUAGCGGUGGAUCACUCGGCUCGUGCGUCGAUGAAGAACGCAGCUAGCUGCGAGAAUUAAUGUGAAUUGCAGGACACAUUGAUCAUCGACACUUCGAACGCACUUGCGGCCCCGGGUUCCUCCCGGGGCUACGCCUGUCUGAGCGUCGCU
Loading diagram...

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
publication title Structure of a prehandover mammalian ribosomal SRP·SRP receptor targeting complex.
pubmed doi rcsb
molecule keywords Canis lupus familiaris RNA, 7SL, cytoplasmic 1 (RN7SL1), SRP
molecule tags Translation
source organism Saccharomyces cerevisiae
total genus 7
structure length 156
sequence length 156
RNA BGSU Site RNA BGSU Site Entry
ec nomenclature
pdb deposition date 2018-02-16
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...