6LNBM

Cryoem structure of cascade-tniq-dsdna complex
Total Genus 0
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
0
sequence length
60
structure length
60
Chain Sequence
CUGAUAACUUCACGGCGGGCUUGAUGUCCGCGUCUACCUGGUGAACUGCCGAGUAGGUAG

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
publication title Structural basis of a Tn7-like transposase recruitment and DNA loading to CRISPR-Cas surveillance complex.
pubmed doi rcsb
source organism Vibrio cholerae
molecule tags Immune system
molecule keywords CRISPR-associated protein Cas7
structure length 60
sequence length 60
RNA BGSU Site RNA BGSU Site Entry
equivalent chains according to BGSU RNA Site 6lnc M
ec nomenclature
pdb deposition date 2019-12-28
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...