6M0XB

Crystal structure of streptococcus thermophilus cas9 in complex with agga pam
Total Genus 0
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
0
sequence length
70
structure length
70
Chain Sequence
GGUGCUAAGAUUAAUCAGGAUGUUUUUGUACUCGAAAGAAGCUACAAAGAUAAGGCUUCAUGCCGAAAUC

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
publication title Catalytic-state structure and engineering of Streptococcus thermophilus Cas9
doi rcsb
molecule tags Dna binding protein
source organism Streptococcus thermophilus lmd-9
molecule keywords CRISPR-associated endonuclease Cas9 1
structure length 70
sequence length 70
RNA BGSU Site RNA BGSU Site Entry
equivalent chains according to BGSU RNA Site 6m0w B 6m0v B
ec nomenclature
pdb deposition date 2020-02-23
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...