6N7RR

Saccharomyces cerevisiae spliceosomal e complex (act1)
Total Genus 11
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
11
sequence length
565
structure length
558
Chain Sequence
AUACUUACCUUAAGAUAUCAGAGGAAAGUCCUACUGAUCAAACAUGCGCUUCCAAUAGUAGAAGGACGUUAAGCAUUUAUCAUUGAACUAUAAUUGUUCAUUGAAGUCAUUGAUGCAAACUCCUUGGUCACACACACAUACGGCGCGGAAGGCGUGUUUGCUGACGUUUCCAUUCCCUUGUUUCAAUCAUUGGUUAAUCCCUUGAUUCCUUUGGGGAUUUUUGGGUUAAACUGAUUUUUGGGGCCCUUUGUUUCUUCUGCCUGGAGAAGUUUGACACCAAAUUCAAAUUGGUGUUAGGGGAGCUGGGGCCUUUCAAAAGAGAGCUUUGUAGAGGCAUUCUUUUUGACUACUUUUCUCUAGCGUGCCAUUUUAGUUUUUGACGGCAGAUUCGAAUGAACUUAAGUUUAUGAUGAAGGUAUGGCUGUUGAGAUUAUUUGGUCGGGAUUGUAGUUUGAAGAUGUGCUCUUUUGAGCAGUCUCAACUUUGCUCGUUCCCGUUAUGGGAAAAAUUUUGGAAGGUCUUGGUAGGAACGGGUGGAUCUUAUAAUUUUUGAUUUAU
Loading diagram...

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
publication title A unified mechanism for intron and exon definition and back-splicing.
pubmed doi rcsb
molecule keywords U1 small nuclear ribonucleoprotein 70 kDa homolog
molecule tags Rna binding protein
source organism Saccharomyces cerevisiae (strain atcc 204508 / s288c)
total genus 11
structure length 558
sequence length 565
RNA BGSU Site RNA BGSU Site Entry
equivalent chains according to BGSU RNA Site 6n7p R 6n7x R
ec nomenclature
pdb deposition date 2018-11-28
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...