The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.
Total Genus |
3
|
sequence length |
76
|
structure length |
67
|
Chain Sequence |
GGGUGAUAGCUCAGGGAGAGCACCUCCCUACAGGAGGGGUCGGCGGCGAUCCCGUCAUCACCCACCA
|
The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.
After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.
molecule tags |
Ribosome
|
molecule keywords |
23S Ribosomal RNA
|
publication title |
Structure of Dirithromycin Bound to the Bacterial Ribosome Suggests New Ways for Rational Improvement of Macrolides.
pubmed doi rcsb |
source organism |
Escherichia coli
|
total genus |
3
|
structure length |
67
|
sequence length |
76
|
RNA BGSU Site |
RNA BGSU Site Entry
|
chains with identical sequence |
1y, 2w, 2y
|
equivalent chains according to BGSU RNA Site |
6cae 1y
6o97 1w
6by1 AW
6o97 1y
6nd6 1y
6by1 BW
6cae 1w
6by1 BV
6by1 AV
6cae 2y
6nd6 1w
6cae 2w
6o97 2y
6nd6 2y
6o97 2w
6nd6 2w
6n1d BP
6n1d AP
6by1 AY
|
ec nomenclature | |
pdb deposition date | 2019-03-28 |
#similar chains in the Genus database (?% sequence similarity) ...loading similar chains, please wait... #similar chains, but unknotted ...loading similar chains, please wait... #similar chains in the pdb database (?% sequence similarity) ...loading similar chains, please wait...