6OLEu

Human ribosome nascent chain complex (cdh1-rnc) stalled by a drug-like molecule with ap and pe trnas
Total Genus 4
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
4
sequence length
76
structure length
76
Chain Sequence
GCCCGGAUAGCUCAGUCGGUAGAGCAGGGGAUUCCGUAUCCCCGUGUCCUUGGUUCGAUUCCGAGUCCGGGCACCA
Loading diagram...

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
publication title Structural basis for selective stalling of human ribosome nascent chain complexes by a drug-like molecule.
pubmed doi rcsb
molecule tags Ribosome
molecule keywords 18S ribosomal RNA
total genus 4
structure length 76
sequence length 76
RNA BGSU Site RNA BGSU Site Entry
equivalent chains according to BGSU RNA Site 6om0 u 6olg Bv 6oli u 6om7 u 6olz Bv 6olf u
ec nomenclature
pdb deposition date 2019-04-16
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...