6ORDQY

Crystal structure of trna^ ala(ggc) u32-a38 bound to cognate 70s a site
Total Genus 5
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
5
sequence length
76
structure length
76
Chain Sequence
GGGGCUAUAGCUCAGCUGGGAGAGCGCUUGCUUGGCAAGCAAGAGGUCAGCGGUUCGAUCCCGCUUAGCUCCACCA
Loading diagram...

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
publication title Disruption of evolutionarily correlated tRNA elements impairs accurate decoding.
pubmed doi rcsb
molecule tags Ribosome
molecule keywords 16S rRNA
total genus 5
structure length 76
sequence length 76
RNA BGSU Site RNA BGSU Site Entry
chains with identical sequence XY
equivalent chains according to BGSU RNA Site 6ord XY 6oj2 XY 6ope QY 6ope XY 6oj2 XW 6of6 XY 6oj2 QY 6oj2 QW 6of6 QY 6of6 QW 6of6 XW
ec nomenclature
pdb deposition date 2019-04-30
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...