The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.
Total Genus |
87
|
sequence length |
1244
|
structure length |
1231
|
Chain Sequence |
ACCAGGUUGAUUCUGCCUGACGUAGACGCUAUUCCCUAAGAUUAACCCAUGCAUGUUUUUGAUAUGGAAAAAUGGACUGCUCAGUAAUACUCACUUUAUUUAAUGUAUUAAAGUAUAACUGCGUUAAAGUGUAGCAUAAGACUAUACAGUAAGAGUGAGACCUAUCAGCUAGUUGUUAAGGUAAUGGCUUAACAAGGCAAUGACGGGUAACGGUAUUACUUUGUAAUAUUCCGGAGAAGGAGCCUGAGAGACGGCUACUAAGUCUAAGGAUUGCAGCAGGGGCGAAACUUGACCUAUGGAUUUUAUCUGAGGCAGUUAUGGGAAGUAAUAUAUUGUUUCAUAUUGUAAAAGUAUAUGAGGUGAUUAAUUGGAGGGCAAAUCAAGUGCCAGCAGCCGCGGUAAUACUUGUUCCAAGAGUGUGUAUGAUGAUUGAUGCAGUUAAAAAGUCCGUAGUUUAUAUUUAAGAAGCAAUAUGAGGUGUACUGUAUAGUUGGGAGAGAGAUGAAAUGUGACGACCCUGACUGGACGAACAGAAGCGAAAGCUGUACACUUGUAUGUAUUUUUUGAACAAGGACGUAAGCUGGAGGAGCGAAGAUGAUUAGAUACCAUUGUAGUUCCAGCAGUAAACUAUGCCGACGAUGUGAUAUGAUAUUAAUUGUAUUAGAUGAUAGAAAUUUGAGUUUUUUGGCUCUGGGGAUAGUAUGAUCGCAAGAUUGAAAAUUAAAGAAAUUGACGGAAGAAUACCACAAGGAGUGGAUUGUGCGGCUUAAUUUGACUCAACGCGAGGUAACUUACCAAUAUUUUAUUAUUCAGAGAAGAUUAAUCUGAGAAUGAUAAUAGUGGUGCAUGGCCGUUUUCAAUGGAUGCUGUGAAGUUGAUUAAUUUCAACAAGACGUGAGACCCUUUUAUUAAUAGACAGACACAAUCAGUGUAGGAAGGAAAGGAUUAAAACAGGUCCGUUAUGCCCUCAGACAUUUUGGGCUGCACGCGCAAUACAAUAGAUAUAUAAUCUUUAUGGGAUAAUAUUUUGUAAGAGAUAUUUGAACUUGGAAUUGCUAGUAAAUUUUAUUAAAUAAGUAGAAUUGAAUGUGUCCCUGUUCUUUGUACACACCGCCCGUCGCUAUCUAAGAUGAUAUGUGUUGUGAAAUUAGUGAAAACUACUUGAACAAUAUGUAUUAGAUCUGAUAUGUCGUAACAUGGUUGCUGUUGGAGAACCAUUAGCAGGAUCAUA
|
The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.
After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.
| publication title |
Evolutionary compaction and adaptation visualized by the structure of the dormant microsporidian ribosome
doi rcsb |
| molecule tags |
Ribosome
|
| molecule keywords |
16S rRNA
|
| total genus |
87
|
| structure length |
1231
|
| sequence length |
1244
|
| RNA BGSU Site |
RNA BGSU Site Entry
|
| ec nomenclature | |
| pdb deposition date | 2019-05-05 |
Image from the rcsb pdb (www.rcsb.org)
#similar chains in the Genus database (?% sequence similarity) ...loading similar chains, please wait... #similar chains, but unknotted ...loading similar chains, please wait... #similar chains in the pdb database (?% sequence similarity) ...loading similar chains, please wait...
