6S0XB

Erythromycin resistant staphylococcus aureus 70s ribosome (delta r88 a89 ul22) in complex with erythromycin.
Total Genus 8
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
8
sequence length
115
structure length
115
Chain Sequence
UCUGGUGACUAUAGCAAGGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCCUUAGCGUCGAUGGUAGUCGAACUUACGUUCCGCUAGAGUAGAACGUUGCCAGGC
Loading diagram...

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
molecule tags Ribosome
molecule keywords 23S ribosomal RNA
publication title Exit tunnel modulation as resistance mechanism of S. aureus erythromycin resistant mutant.
pubmed doi rcsb
total genus 8
structure length 115
sequence length 115
RNA BGSU Site RNA BGSU Site Entry
ec nomenclature
pdb deposition date 2019-06-18
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...