6SY4C

Tetr in complex with the tetr-binding rna-aptamer k1
Total Genus 2
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
2
sequence length
38
structure length
36
Chain Sequence
CGGAGAAUGUUAUGGCGCGAGCGCAGAGAAAACCGG
Loading diagram...

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
molecule tags Dna binding protein
molecule keywords Tetracycline repressor protein class B from transposon Tn10
publication title The complex formed between a synthetic RNA aptamer and the transcription repressor TetR is a structural and functional twin of the operator DNA-TetR regulator complex
rcsb
source organism Escherichia coli
total genus 2
structure length 36
sequence length 38
RNA BGSU Site RNA BGSU Site Entry
ec nomenclature
pdb deposition date 2019-09-27
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...