6T4Q6

Structure of yeast 80s ribosome stalled on the cga-ccg inhibitory codon combination.
Total Genus 3
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
3
sequence length
76
structure length
76
Chain Sequence
UUCCUCGUGGCCCAAUGGUCACGGCGUCUGGCUICGAACCAGAAGAUUCCAGGUUCAAGUCCUGGCGGGGAAGCCA
Loading diagram...

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
molecule tags Translation
molecule keywords 18S rRNA
publication title Molecular mechanism of translational stalling by inhibitory codon combinations and poly(A) tracts
doi rcsb
total genus 3
structure length 76
sequence length 76
RNA BGSU Site RNA BGSU Site Entry
equivalent chains according to BGSU RNA Site 6t7i 6
ec nomenclature
pdb deposition date 2019-10-14
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...