6TPQV

Rnase m5 bound to 50s ribosome with precursor 5s rrna
Total Genus 6
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
6
sequence length
123
structure length
123
Chain Sequence
UUUGUUUGGUGGCGAUAGCGAAGAGGUCACACCCGUUCCCAUACCGAACACGGAAGUUAAGCUCUUCAGCGCCGAUGGUAGUCGGGGGUUUCCCCCUGUGAGAGUAGGACGCCGCCAAGCAAG
Loading diagram...

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
publication title CryoEM structures of maturation RNases captured on pre-ribosome
rcsb
molecule keywords Ribonuclease M5
molecule tags Ribosomal protein
source organism Geobacillus stearothermophilus
total genus 6
structure length 123
sequence length 123
RNA BGSU Site RNA BGSU Site Entry
equivalent chains according to BGSU RNA Site 6tnn V 6ppf B
ec nomenclature
pdb deposition date 2019-12-13
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...