6TW1V

Bat influenza a polymerase termination complex with pyrophosphate using 44-mer vrna template with mutated oligo(u) sequence
Total Genus 0
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
0
sequence length
38
structure length
33
Chain Sequence
AGUAGUAACAAGAGCAAUGUGUCCGUCUCUGCU

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
publication title A structure-based model for the complete transcription cycle of influenza polymerase
rcsb
molecule tags Viral protein
source organism Influenza a virus (a/little yellow-shouldered bat/guatemala/060/2010(h17n10))
molecule keywords Polymerase acidic protein
structure length 33
sequence length 38
RNA BGSU Site RNA BGSU Site Entry
ec nomenclature
pdb deposition date 2020-01-11
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...