6VRBB

Cryo-em structure of acrvia1-cas13(crrna) complex
Total Genus 0
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
0
sequence length
52
structure length
52
Chain Sequence
GACUACCUCUAUAUGAAAGAGGACUAAAACCAUAUUUCCAAACUCCACUUUG

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
molecule tags Immune system
molecule keywords RNA (52-MER)
publication title A phage-encoded anti-CRISPR enables complete evasion of type VI-A CRISPR-Cas immunity.
pubmed doi rcsb
source organism Listeria seeligeri serovar 1/2b (strain atcc 35967 / dsm 20751 / cip 100100 / sl
structure length 52
sequence length 52
RNA BGSU Site RNA BGSU Site Entry
ec nomenclature
pdb deposition date 2020-02-07
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...