6VRCB

Cryo-em structure of cas13(crrna)
Total Genus 1
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
1
sequence length
51
structure length
51
Chain Sequence
GACUACCUCUAUAUGAAAGAGGACUAAAACCAUAUUUCCAAACUCCACUUU
Loading diagram...

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
publication title A phage-encoded anti-CRISPR enables complete evasion of type VI-A CRISPR-Cas immunity.
pubmed doi rcsb
molecule keywords CRISPR-associated endoribonuclease Cas13a
molecule tags Immune system
source organism Listeria seeligeri serovar 1/2b (strain atcc 35967 / dsm 20751 / cip 100100 / sl
total genus 1
structure length 51
sequence length 51
RNA BGSU Site RNA BGSU Site Entry
ec nomenclature
pdb deposition date 2020-02-07
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...