6W2TA

Structure of the cricket paralysis virus 5-utr ires (crpv 5-utr-ires) bound to the small ribosomal subunit in the closed state (class 2)
Total Genus 4
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
4
sequence length
339
structure length
339
Chain Sequence
UUCGAUACCAAGAGCUGGUGUCUGAGGGAUUACGACUCGCGUGGUCGGACAGCACAUGUUAGUCAUGUAUUAUGGUGUUUCCCAACACGUAUCUUUGCUCUAGUAUUGAACUUUAGUGAUGAGUGUACUUGGCAUGUACACCUGAUUAGUUAGCCCUUGUGGAUACGCCACUGCCGCUCAGGUACAGUAGGACAUACCCCAAAUAUUGGGUUUUUUUUUUAGAGAAGAAAAUUAGUGGCGAAACGUACGGUUUAUGUCAAAGGAGAAGGUGAUUUUAAUUGCACCUGAAGCAACCCUAGGUCUUCCCUUUGAUGUGAGCUAAUAAGGAGUAACCGAUUC
Loading diagram...

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
publication title A complex IRES at the 5'-UTR of a viral mRNA assembles a functional 48S complex via an uAUG intermediate
rcsb
molecule tags Ribosome
source organism Cricket paralysis virus
molecule keywords 18S rRNA
total genus 4
structure length 339
sequence length 339
RNA BGSU Site RNA BGSU Site Entry
equivalent chains according to BGSU RNA Site 6w2s 0
ec nomenclature
pdb deposition date 2020-03-08
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...