7C79A

Cryo-em structure of yeast ribonuclease mrp
Total Genus 16
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively. For RNA structures we plot several genus traces for various types of base pairs, as explained here.

Total Genus
16
sequence length
335
structure length
331
Chain Sequence
AAUCCAUGACCAAAGAAUCGUCACAAAUCGAAGCUUACAAAAUGGAGUAAAAUUUUGUUUACUCAGUAAUAUGCUUUGGGUUGAAAGUCUCCCACCAAUUCGUAUGCGGAAAACGUAAUGAGAUUUAAAAAUAAUUGUUUAAAUCAACUCAUUAAGGAGGAUGCCCUUGGGUAUUCUGCUUCUUGACCUGGUACCUCUAUUGCAGGGUACUGGUGUUUUCUUCGGUACUGGAUUCCGUUUGUAUGGAAUCUAAACCAUAGUUAUGACGAUUGCUCUUUCCCGUGCUGGAUCGAGUAACCCAAUGGAGCUUACUAUUCUUGGUCCAUGGAUU
Loading diagram...

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
publication title Structural insight into precursor ribosomal RNA processing by ribonuclease MRP.
pubmed doi rcsb
molecule keywords Ribonuclease MRP RNA subunit NME1
molecule tags Rna binding protein
total genus 16
structure length 331
sequence length 335
RNA BGSU Site RNA BGSU Site Entry
equivalent chains according to BGSU RNA Site 7c7a A 6w6v A
ec nomenclature
pdb deposition date 2020-05-24
Image from the rcsb pdb (www.rcsb.org)
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

 
#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...