Found 3009 chains in Genus chains table. Displaying 151 - 200. Applied filters: Proteins

Search results query: Arc Repressor Mutant, subunit A

Total Genus Sequence Length pdb Title
21 62 4kmfA Crystal structure of zalpha domain from carassius auratus pkz in complex with z-dna
29 91 4ihwA Crystal structure of fis bound to 27 bp inosine substituted dna f28-di (aaatttgtttgaicittgagcaaattt)
34 89 4ihtA Crystal structure of benm_dbd/bena site 1 dna complex
65 198 4i2oA The structure of fixk2 from bradyrhizobium japonicum
20 60 4lb5A Crystal structure of pkz zalpha in complex with ds(cg)6 (hexagonal form)
35 104 4l0yB Crystal structure of runx1 and ets1 bound to tcr alpha promoter (crystal form 1)
33 101 4l0zB Crystal structure of runx1 and ets1 bound to tcr alpha promoter (crystal form 2)
37 106 4lg0B Structure of a ternary foxo1-ets1 dna complex
71 226 4knyA Crystal structure of the response regulator kdpe complexed to dna in an active-like conformation
28 91 4ihxA Crystal structure of fis bound to 27 bp 2-aminopurine substituted dna f28-2ap (aaatttgtttga2t2ttgagcaaattt)
72 254 4kywA Restriction endonuclease dpni in complex with two dna molecules
101 368 4ikfA Pfv intasome with inhibitor mb-76
37 107 4l18B Crystal structure of runx1 and ets1 bound to tcr alpha promoter (crystal form 3)
50 137 4llnA Crystal structure of s. aureus mepr-dna complex
41 151 4kdpA Tcar-ssdna complex crystal structure reveals the novel ssdna binding mechanism of the marr family proteins
27 91 4ihvA Crystal structure of fis bound to 27 bp sequence dna f28 (aaatttgtttgagcgttgagcaaattt)
71 226 4kfcA Crystal structure of a hyperactive mutant of response regulator kdpe complexed to its promoter dna
33 89 4ihsA Crystal structure of benm_dbd/catb site 1 dna complex
43 144 4hf1A Crystal structure of iscr bound to its promoter
29 132 4hf2A Crystal structure of e43a iscr mutant bound to its promoter
56 238 4gfbA Rap1/dna complex
42 149 4ejtA Staphylococcus epidermidis tcar in complex with rna
32 94 4iriA Auto-inhibited erg ets domain-dna complex
64 295 4hriA Crystal structure of hetr in complex with a 21-bp palindromic dna at the upstream of the hetp promoter from anabaena
145 497 4gdfA A crystal structure of sv40 large t antigen
39 132 4bqaA Crystal structure of the ets domain of human ets2 in complex with dna
41 140 4chuA E. coli iscr-dna complex
243 661 4c2uA Crystal structure of deinococcus radiodurans uvrd in complex with dna, form 1
16 65 4by1J Elongating rna polymerase ii-bye1 tld complex soaked with ampcpp
225 658 4c2tA Crystal structure of full length deinococcus radiodurans uvrd in complex with dna
28 95 4bncA Crystal structure of the dna-binding domain of human etv1 complexed with dna
41 111 3w6vA Crystal structure of the dna-binding domain of adpa, the global transcriptional factor, in complex with a target dna
109 373 2qbyA Crystal structure of a heterodimer of cdc6/orc1 initiators bound to origin dna (from s. solfataricus)
19 55 3hddA Engrailed homeodomain dna complex
51 140 2iszA Crystal structure of a two-domain ider-dna complex crystal form i
19 63 2o9lA Amber refined nmr structure of the sigma-54 rpon domain bound to the-24 promoter element
33 134 2jq7A Model for thiostrepton binding to the ribosomal l11-rna
202 649 3pjrA Helicase substrate complex
173 542 2pjrA Helicase product complex
14 82 2p7cB Solution structure of the bacillus licheniformis blai monomeric form in complex with the blap half-operator.
62 159 3zplA Crystal structure of sco3205, a marr family transcriptional regulator from streptomyces coelicolor, in complex with dna
12 70 3cc7I Structure of anisomycin resistant 50s ribosomal subunit: 23s rrna mutation c2487u
19 96 2stwA Solution nmr structure of the human ets1/dna complex, restrained regularized mean structure
20 54 2qshX Crystal structure of rad4-rad23 bound to a mismatch dna
22 91 3htsB Heat shock transcription factor/dna complex
71 260 2nraC Crystal structure of pi initiator protein in complex with iteron dna
17 110 2o6gE Crystal structure of irf-3 bound to the interferon-b enhancer
11 70 3cc2I The refined crystal structure of the haloarcula marismortui large ribosomal subunit at 2.4 angstrom resolution with rrna sequence for the 23s rrna and genome-derived sequences for r-proteins
10 65 2yu9J Rna polymerase ii elongation complex in 150 mm mg+2 with utp
37 116 3vwbA Crystal structure of virb core domain (se-met derivative) complexed with the cis-acting site (5-bru modifications) upstream icsb promoter