Found 28394 chains in Genus chains table. Displaying 901 - 950. Applied filters: Proteins

Search results query: Orthogonal Bundle

Total Genus Sequence Length pdb Title
122 362 4i2fA Binary complex of mouse tdt with ssdna
33 87 4ji2O Crystal structure of 30s ribosomal subunit from thermus thermophilus
123 362 4iqwA Tdt core in complex with inhibitor (2z,5e)-6-[4-(4-fluorobenzoyl)-1h-pyrrol-2-yl]-2-hydroxy-4-oxohexa-2,5-dienoic acid and ssdna
29 118 4ji8M Crystal structure of 30s ribosomal subunit from thermus thermophilus
32 106 4kgcC Nucleosome core particle containing (eta6-p-cymene)-(1, 2-ethylenediamine)-ruthenium
69 234 4ji4B Crystal structure of 30s ribosomal subunit from thermus thermophilus
25 118 4ji4M Crystal structure of 30s ribosomal subunit from thermus thermophilus
44 155 4ji0G Crystal structure of 30s ribosomal subunit from thermus thermophilus
33 89 4ihsA Crystal structure of benm_dbd/catb site 1 dna complex
30 118 4ji7M Crystal structure of 30s ribosomal subunit from thermus thermophilus
29 118 4ji5M Crystal structure of 30s ribosomal subunit from thermus thermophilus
322 1172 3k70B Crystal structure of the complete initiation complex of recbcd
71 226 4kfcA Crystal structure of a hyperactive mutant of response regulator kdpe complexed to its promoter dna
27 91 4ihvA Crystal structure of fis bound to 27 bp sequence dna f28 (aaatttgtttgagcgttgagcaaattt)
71 234 4ji8B Crystal structure of 30s ribosomal subunit from thermus thermophilus
27 82 4kgcB Nucleosome core particle containing (eta6-p-cymene)-(1, 2-ethylenediamine)-ruthenium
33 87 4ji8O Crystal structure of 30s ribosomal subunit from thermus thermophilus
237 750 4g0vA Human topoisomerase iibeta in complex with dna and mitoxantrone
46 155 4ji2G Crystal structure of 30s ribosomal subunit from thermus thermophilus
30 75 4i8tA C.esp1396i bound to a 19 base pair dna duplex
46 155 4ji7G Crystal structure of 30s ribosomal subunit from thermus thermophilus
31 94 4jqdA Crystal structure of the restriction-modification controller protein c.csp231i ol operator complex
299 1449 3gtjA Backtracked rna polymerase ii complex with 13mer rna
31 87 4ji4O Crystal structure of 30s ribosomal subunit from thermus thermophilus
59 208 4ji1D Crystal structure of 30s ribosomal subunit from thermus thermophilus
32 87 4ji7O Crystal structure of 30s ribosomal subunit from thermus thermophilus
61 208 4ji3D Crystal structure of 30s ribosomal subunit from thermus thermophilus
76 234 4ji7B Crystal structure of 30s ribosomal subunit from thermus thermophilus
113 326 4jwmA Ternary complex of d256e mutant of dna polymerase beta
123 362 4i2aA Binary complex of mouse tdt with ssdna in absence of divalent transition metal ion
103 333 4k4iA Ternary crystal structures of a human dna polymerase lambda in complex with dna and (-)ftc-tp.
49 155 4ji8G Crystal structure of 30s ribosomal subunit from thermus thermophilus
59 208 4ji6D Crystal structure of 30s ribosomal subunit from thermus thermophilus
111 326 4jwnA Ternary complex of d256a mutant of dna polymerase beta
117 341 4jv1A Ternary complex of gamma-ohpdg adduct modified dna with dna (-1 primer) polymerase iv and incoming dgtp
34 87 4ji6O Crystal structure of 30s ribosomal subunit from thermus thermophilus
40 155 4ji4G Crystal structure of 30s ribosomal subunit from thermus thermophilus
292 860 4cqnA Crystal structure of the e.coli leurs-trna complex with the non- cognate isoleucyl adenylate analogue
38 155 4ji1G Crystal structure of 30s ribosomal subunit from thermus thermophilus
57 208 4ji7D Crystal structure of 30s ribosomal subunit from thermus thermophilus
59 208 4ji5D Crystal structure of 30s ribosomal subunit from thermus thermophilus
75 234 4ji2B Crystal structure of 30s ribosomal subunit from thermus thermophilus
59 208 4ji8D Crystal structure of 30s ribosomal subunit from thermus thermophilus
106 331 4k4gA Ternary crystal structures of human dna polymerase lambda in complex with dna and l-dctp.
30 118 4ji2M Crystal structure of 30s ribosomal subunit from thermus thermophilus
108 342 4irkA Structure of polymerase-dna complex, dna
268 857 4as1A Ternary complex of e. coli leucyl-trna synthetase, trna(leu) and the benzoxaborole an2679 in the editing conformation
125 362 4i2gA Binary complex of mouse tdt with ssdna
102 342 4ir9A Polymerase-dna complex
29 132 4hf2A Crystal structure of e43a iscr mutant bound to its promoter