Found 28394 chains in Genus chains table. Displaying 3651 - 3700. Applied filters: Proteins

Search results query: Orthogonal Bundle

Total Genus Sequence Length pdb Title
114 329 5dbaA Structure of human dna polymerase beta host-guest complex with the dg base paired with a dt
80 295 4yrvA Crystal structure of anabaena transcription factor hetr complexed with 21-bp dna from hetp promoter
59 208 4x65D Crystal structure of 30s ribosomal subunit from thermus thermophilus
100 329 5db7A Structure of human dna polymerase beta host-guest complex with the n7mg base paired with a dt
78 235 5br8B Ambient-temperature crystal structure of 30s ribosomal subunit from thermus thermophilus in complex with paromomycin
21 59 4xrmA Homodimer of tale type homeobox transcription factor meis1 complexes with specific dna
59 208 4x62D Crystal structure of 30s ribosomal subunit from thermus thermophilus
43 155 4x62G Crystal structure of 30s ribosomal subunit from thermus thermophilus
42 164 4wx9A Crystal structure of mycobacterium tuberculosis ogt in complex with dna
205 861 4rulA Crystal structure of full-length e.coli topoisomerase i in complex with ssdna
21 61 4wcgA The binding mode of cyprinid herpesvirus3 orf112-zalpha to z-dna
130 475 4rqfA Human seryl-trna synthetase dimer complexed with one molecule of trnasec
69 235 4x62B Crystal structure of 30s ribosomal subunit from thermus thermophilus
27 88 4x62O Crystal structure of 30s ribosomal subunit from thermus thermophilus
28 118 4x62M Crystal structure of 30s ribosomal subunit from thermus thermophilus
121 478 4rqeA Human seryl-trna synthetase dimer complexed with two molecules of trnasec
61 219 4s05A Crystal structure of klebsiella pneumoniae pmra in complex with pmra box dna
25 99 5iydO Human core-pic in the initial transcribing state (no iis)
73 219 4s04A Crystal structure of klebsiella pneumoniae pmra in complex with pmra box dna
25 82 4xujB Nucleosome core particle containing adducts from treatment with a thiomorpholine-substituted [(eta-6-p-cymene)ru(3-hydroxy-2-pyridone)cl] compound
33 99 5av9A Human nucleosome core particle
20 92 5k5oA Structure of aspa-26mer dna complex
38 97 5av6D Human nucleosome core particle
32 106 5av9C Human nucleosome core particle
27 82 5avbB Human nucleosome core particle
143 488 4u6pA Structural mechanism of error-free bypass of major benzo[a]pyrene adduct by human polymerase kappa
76 246 5chgA Human dna polymerase lambda l431a mutant- mgdgtp binary and complex with 6 paired dna
26 107 5d5vB Crystal structure of human hsf1 with satellite iii repeat dna
31 97 4zuxA Saga dub module ubp8/sgf11/sus1/sgf73 bound to ubiqitinated nucleosome
27 91 5e3mA Crystal structure of fis bound to 27bp dna f35 (aaattagtttgaatctcgagctaattt)
31 96 5b0zA The crystal structure of the nucleosome containing h3.2, at 1.98 a resolution
32 108 5b0zC The crystal structure of the nucleosome containing h3.2, at 1.98 a resolution
105 343 4rocA Human tfiib-related factor 2 (brf2) and tbp bound to u6#2 promoter
34 93 5b24D The crystal structure of the nucleosome containing cyclobutane pyrimidine dimer
99 342 4rodA Human tfiib-related factor 2 (brf2) and tbp bound to trnau1 promoter
27 91 5e3oA Crystal structure of fis bound to 27bp dna f32 (aaatttggaggaattttctccaaattt)
24 78 5b24B The crystal structure of the nucleosome containing cyclobutane pyrimidine dimer
33 106 5av5C Human nucleosome core particle
32 99 5av6A Human nucleosome core particle
81 246 5cj7A Human dna polymerase lambda l431a mutant- mgdttp binary and complex with 6 paired dna
26 82 5av5B Human nucleosome core particle
36 97 5avcD Human nucleosome core particle
109 326 5cwrA Crystal structure of human dna polymerase lambda l431a mutant in complex with a one nucleotide dna gap and dctp
26 107 5d5uB Crystal structure of human hsf1 with hse dna
33 106 5avcC Human nucleosome core particle
35 93 5b0yD Crystal structure of the nucleosome containing histone h3 with the crotonylated lysine 122
32 105 5b0yC Crystal structure of the nucleosome containing histone h3 with the crotonylated lysine 122
107 366 5dnyA Structure of the atprs-mre11/rad50-dna complex
31 99 5avbA Human nucleosome core particle
30 97 5b24A The crystal structure of the nucleosome containing cyclobutane pyrimidine dimer