Found 28394 chains in Genus chains table. Displaying 3701 - 3750. Applied filters: Proteins

Search results query: Orthogonal Bundle

Total Genus Sequence Length pdb Title
33 99 5av8A Human nucleosome core particle
105 329 4yn4A Structure of human dna polymerase beta complexed with n7bg in the template opposite to incoming non-hydrolyzable dttp with manganese in the active site
34 89 4zuxV Saga dub module ubp8/sgf11/sus1/sgf73 bound to ubiqitinated nucleosome
33 96 5b0yA Crystal structure of the nucleosome containing histone h3 with the crotonylated lysine 122
35 94 5b0zD The crystal structure of the nucleosome containing h3.2, at 1.98 a resolution
28 82 5av9B Human nucleosome core particle
107 327 5dkwA Ternary crystal structure of polymerase lambda with a ga mispair at the primer terminus with ca2+ in the active
37 97 5av8D Human nucleosome core particle
111 329 4ymmA Structure of human dna polymerase beta complexed with 7bg as the template base in a 1-nucleotide gapped dna
23 102 5d5wB Crystal structure of chaetomium thermophilum skn7 with hse dna
39 97 5av9D Human nucleosome core particle
22 76 4s2qD Crystal structure of hmg domain of the chondrogenesis master regulator, sox9 in complex with chip-seq identified dna element
32 106 5av6C Human nucleosome core particle
28 108 5b24C The crystal structure of the nucleosome containing cyclobutane pyrimidine dimer
141 487 4u7cA Structure of dna polymerase kappa in complex with benzopyrene adducted dna
69 243 4xrhA Human dna polymerase lambda- mgdttp binary and complex with 6 paired dna
139 488 5t14A Dna polymerase kappa extending beyond a bulky major benzo[a]pyrene adduct
25 83 4zuxB Saga dub module ubp8/sgf11/sus1/sgf73 bound to ubiqitinated nucleosome
31 99 5avcA Human nucleosome core particle
38 97 5avbD Human nucleosome core particle
118 346 5e18F T. thermophilus transcription initiation complex having a yyy discriminator sequence and a nontemplate-strand length corresponding to tss selection at position 8 (rpo-ccc-8)
27 82 5av6B Human nucleosome core particle
32 106 5av8C Human nucleosome core particle
72 242 5ddmA Human dna polymerase lambda- apoenzyme and complex with 6 paired dna
108 324 4xusA Crystal structure of the pre-catalytic ternary complex of dna polymerase lambda with a templating a and an incoming dttp
37 95 4zuxD Saga dub module ubp8/sgf11/sus1/sgf73 bound to ubiqitinated nucleosome
27 78 5b0yB Crystal structure of the nucleosome containing histone h3 with the crotonylated lysine 122
30 106 4xujC Nucleosome core particle containing adducts from treatment with a thiomorpholine-substituted [(eta-6-p-cymene)ru(3-hydroxy-2-pyridone)cl] compound
27 91 5e3nA Crystal structure of fis bound to 27bp dna f31 (aaatttgtaggaattttctgcaaattt)
38 97 5av5D Human nucleosome core particle
72 243 5ca7A Human dna polymerase lambda- mgdgtp binary and complex with 6 paired dna
29 103 4zuxC Saga dub module ubp8/sgf11/sus1/sgf73 bound to ubiqitinated nucleosome
27 78 5b0zB The crystal structure of the nucleosome containing h3.2, at 1.98 a resolution
105 330 5tzvA Binary complex crystal structure of dna polymerase beta with g:t mismatch at the primer terminus
29 89 5k5qA Structure of aspa-dna complex: novel centromere bindng protein-centromere complex
14 67 5iycJ Human core-pic in the initial transcribing state
22 87 5k1yA P2(1) structure of pnob8 aspa-dna complex
26 89 5k5rA Aspa-32mer dna,crystal form 2
26 99 5iycO Human core-pic in the initial transcribing state
28 125 5iwaM Crystal structure of the 30s ribosomal subunit from thermus thermophilus in complex with the ge81112 peptide antibiotic
57 208 5iwaD Crystal structure of the 30s ribosomal subunit from thermus thermophilus in complex with the ge81112 peptide antibiotic
130 304 5in8A Crystal structure of q151h aspergillus terreus aristolochene synthase
80 226 5iwaB Crystal structure of the 30s ribosomal subunit from thermus thermophilus in complex with the ge81112 peptide antibiotic
33 88 5iwaO Crystal structure of the 30s ribosomal subunit from thermus thermophilus in complex with the ge81112 peptide antibiotic
35 155 5iwaG Crystal structure of the 30s ribosomal subunit from thermus thermophilus in complex with the ge81112 peptide antibiotic
49 206 5it9F Structure of the yeast kluyveromyces lactis small ribosomal subunit in complex with the cricket paralysis virus ires.
107 272 5hnkA Crystal structure of t5fen in complex intact substrate and metal ions.
18 67 5i44A Structure of raca-dna complex; p21 form
94 343 5hooA Crystal structure of the mos1 strand transfer complex
150 435 5dg8A Crystal structure of human dna polymerase eta inserting dampnpp across a dna template containing 1,n6-ethenodeoxyadenosine lesion