Found 3009 chains in Genus chains table. Displaying 701 - 750. Applied filters: Proteins

Search results query: Arc Repressor Mutant, subunit A

Total Genus Sequence Length pdb Title
21 59 4xrmA Homodimer of tale type homeobox transcription factor meis1 complexes with specific dna
42 164 4wx9A Crystal structure of mycobacterium tuberculosis ogt in complex with dna
21 61 4wcgA The binding mode of cyprinid herpesvirus3 orf112-zalpha to z-dna
61 219 4s05A Crystal structure of klebsiella pneumoniae pmra in complex with pmra box dna
73 219 4s04A Crystal structure of klebsiella pneumoniae pmra in complex with pmra box dna
27 91 5e3oA Crystal structure of fis bound to 27bp dna f32 (aaatttggaggaattttctccaaattt)
26 107 5d5uB Crystal structure of human hsf1 with hse dna
26 107 5d5vB Crystal structure of human hsf1 with satellite iii repeat dna
27 91 5e3mA Crystal structure of fis bound to 27bp dna f35 (aaattagtttgaatctcgagctaattt)
20 92 5k5oA Structure of aspa-26mer dna complex
118 346 5e18F T. thermophilus transcription initiation complex having a yyy discriminator sequence and a nontemplate-strand length corresponding to tss selection at position 8 (rpo-ccc-8)
27 91 5e3nA Crystal structure of fis bound to 27bp dna f31 (aaatttgtaggaattttctgcaaattt)
23 102 5d5wB Crystal structure of chaetomium thermophilum skn7 with hse dna
22 87 5k1yA P2(1) structure of pnob8 aspa-dna complex
26 89 5k5rA Aspa-32mer dna,crystal form 2
14 67 5iycJ Human core-pic in the initial transcribing state
29 89 5k5qA Structure of aspa-dna complex: novel centromere bindng protein-centromere complex
94 343 5hooA Crystal structure of the mos1 strand transfer complex
74 230 5ed4A Structure of a phop-dna complex
22 57 5jlwA Antphd with 15bp dna duplex r-monothioated at cytidine-8
31 96 5jvtA Crystal structure of the dna binding domain of transcription factor fli1 in complex with an 11-mer dna gaccggaagtg
108 280 5hnfA Crystal structure of pyrene- and phenanthrene-modified dna in complex with the bpuj1 endonuclease binding domain
94 278 5hltA Crystal structure of pyrene- and phenanthrene-modified dna in complex with the bpuj1 endonuclease binding domain
67 185 5k7zA Crystal structure of aibr in complex with isovaleryl coenzyme a and operator dna
73 236 5lrsA The transcriptional regulator prfa from listeria monocytogenes in complex with glutathione and a 30-bp operator prfa-box motif
69 236 5lejA The transcriptional regulator prfa from listeria monocytogenes in complex with a 30-bp operator prfa-box motif
70 236 5lekA The transcriptional regulator prfa-g145s mutant from listeria monocytogenes in complex with a 30-bp operator prfa-box motif
12 69 5m5yJ Rna polymerase i elongation complex 2
11 69 5m5xJ Rna polymerase i elongation complex 1
27 91 5ds9A Crystal structure of fis bound to 27bp dna f1-8a (aaattagtttgaattttgagctaattt)
19 86 5duiA Identification of a new foxo1 binding site that precludes creb binding at the glucose-6-phosphatase catalytic subunit gene promoter
107 279 5hnhA Crystal structure of pyrene- and phenanthrene-modified dna in complex with the bpuj1 endonuclease binding domain
40 144 5hlhA Crystal structure of the overoxidized abfr bound to dna
48 144 5hlgA Structure of reduced abfr bound to dna
30 105 5hdnA Crystal structure of heat shock factor1-dbd complex with ds-dna and ttt
17 61 5hodA Structure of lhx4 transcription factor complexed with dna
53 138 5fb2A S. aureus mepr f27l mutant bound to oligodeoxyribonucleotide
69 190 5gpcA Structural analysis of fatty acid degradation regulator fadr from bacillus halodurans
20 61 5ef6A Structure of hoxb13 complex with methylated dna
81 193 5j1yA Structure of transcriptional regulatory repressor protein - ethr from mycobacterium tuberculosis in complex with 1-(pyrrolidin-1-yl)-3-(tetrahydrofuran-3-yl)propan-1-one at 1.81a resolution
82 193 5j1rA Structure of transcriptional regulatory repressor protein - ethr from mycobacterium tuberculosis in complex with 3-(furan-3-yl)-1-(pyrrolidin-1-yl)propan-1-one at 1.92a resolution
26 79 5iy5H Electron transfer complex of cytochrome c and cytochrome c oxidase at 2.0 angstrom resolution
29 92 5ilvA Uninhibited etv5
30 97 5iluA Autoinhibited etv4
60 185 4cxfA Structure of cnrh in complex with the cytosolic domain of cnry
218 666 5l3cA Human lsd1/corest: lsd1 e379k mutation
228 666 5lbqA Lsd1-corest1 in complex with quinazoline-derivative reversible inhibitor
235 666 5lgtA Thieno[3,2-b]pyrrole-5-carboxamides as novel reversible inhibitors of histone lysine demethylase kdm1a/lsd1: compound 15
43 151 5llqA Crystal structure of sulfolobus solfataricus o6-methylguanine methyltransferase c119f variant
188 512 5lfaA Crystal structure of iron-sulfur cluster containing bacterial (6-4) photolyase phrb - y424f mutant with impaired dna repair activity